Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting copy number variation of PLP1 gene

A gene copy number, PLP1 technology, applied in the field of biomedical detection, can solve the problems of high sensitivity and unsuitable for high-throughput detection, and achieve the effect of low pre-experimental cost

Pending Publication Date: 2021-03-12
CHANGSHA KINGMED MEDICAL DIAGNOSTICS INST
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is simple and easy to operate, with high sensitivity, good repeatability, fast speed and less pollution, but it is not suitable for high-throughput detection of large samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting copy number variation of PLP1 gene
  • Kit for detecting copy number variation of PLP1 gene
  • Kit for detecting copy number variation of PLP1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0041] 1, primer test

[0042] 1) Linear DNA Preparation (Table 1): Dilute the standard Human Genetic DNA (253NG / UL) gradient, take 13 ul DDH 2 O, vortex, slightly, concentration is 66 ng / ul.

[0043] Then 10 times gradient dilution, add 20 ul to 180 ul DDH 2 O, each time you need full vortex mixing to make the next gradient dilution.

[0044] Table 1

[0045]

[0046] 2) Experimental system (Table 2)

[0047] Table 2

[0048]

[0049] 3) Amplification procedure (Table 3)

[0050] table 3

[0051]

[0052] 4) Result analysis

[0053] ABI7500 setting:

[0054] Experiment PROP Select QuantuTation-Relative Standard Curve and Sybrgreen Reagents.

[0055] The results are as follows:

[0056] Primer OTC-L: primer amplification efficiency 92.6%, solubilized peak single;

[0057] Primer OTC-M: primer amplification efficiency 99%, solubilized peak single;

[0058] Primer OTC-R: primer amplification efficiency of 93.1%, solubolic peak single;

[0059] Primer RP: primer amplification...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting copy number variation of a PLP1 gene. The kit comprises the following primer pairs: Q-PLP1-LF: GGTCACATACACCCTGTCAAC, Q-PLP1-LR: ccagagcgagcaccttaacatcgc ,Q-PLP1-MF: CAAGGTTTCACCACTGTTCAAATC, Q-PLP1-MR: ccatctctaattatcctgggaG, Q-PLP1-RF: GGGATTTGAGGAGGGAGACC, and Q-PLP1-RR: ggacggcaaagttgtaagACgC . The kit is simple, rapid, low in pre-experiment cost and suitable for small-batch detection and verification.

Description

Technical field [0001] The present invention belongs to the field of biomedical detection, and more particularly to a kit for detecting a PLP1 gene copy number variant. Background technique [0002] If a PLP1 gene occurs, such as a pathogenic mutation can cause Pelizaeus-Merzbacher's disease and spasale paraplegia 2, usually in the manner in which the X chromosome is hidden. Pelizaeus-Merzbacher disease is a slow brain taline malnutrition. There is a lot of newborns or infants, accompanied by eye tremor, and usually associated with muscle tension, slow development slow, language development and slow language development. Over time, muscle tension will usually develop to a state of sputum, which will affect walking and communication. Cardinal symptoms (gait disorders, exercise disorders, intentional tremors, head dynamic disorders, etc.) often appear during children, some patients may have abnormal percutaneous exercise, loss of hearing loss and optic atrophy. Among the PLP1 gene ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2531/113C12Q2545/101C12Q2537/16C12Q2563/107
Inventor 余艳周梅华李慧源葛虎朱加琳唐春燕
Owner CHANGSHA KINGMED MEDICAL DIAGNOSTICS INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com