Product
Eureka
For R&D, Eureka makes reading and utilizing patents & technical documents easy.
Eureka AIR
Designed for self-driven R&D workflows. Generate viable solutions, solve complex R&D challenges, empower your innovation with AI.
Eureka Materials
Designed for material experts only. Revolutionize your material R&D, from search, analyze, to developing new materials.
Feature
TechResearch
Generate reliable direction feasibility study reports for your R&D in just a few steps.
TechSeek
Discover and master advanced knowledge NOW. Basics, ideas, possibilities, all at once.
TechMind
As an expert in R&D Theories, TechMind can generates customized viable solutions instantly.
TechRisk
Analyze your overall solution with one click, know your potential R&D risks in advance.
TechMonitor
Get weekly tech updates, stay abreast of the latest tech innovations and key insights.
Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
80 results about "RpoB" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
The rpoB gene encodes the β subunit of bacterial RNA polymerase. rpoB is also found in plant chloroplasts where it forms the beta subunit of the plastid-encoded RNA polymerase (PEP). An inhibitor of transcription in bacteria, tagetitoxin, also inhibits PEP, showing that the complex found in plants is very similar to the homologous enzyme in bacteria. It codes for 1342 amino acids, making it the second-largest polypeptide in the bacterial cell. It is the site of mutations that confer resistance to the rifamycin antibacterial agents, such as rifampin. Mutations in rpoB that confer resistance to rifamycins do so by altering residues of the rifamycin binding site on RNA polymerase, thereby reducing rifamycin binding affinity for rifamycins...
Chip-based species identification and phenotypic characterization of microorganisms
This invention provides oligonucleotide based arrays and methods for speciating and phenotyping organisms, for example, using oligonucleotide sequences based on the Mycobacterium tubercluosis rpoB gene. The groups or species to which an organism belongs may be determined by comparing hybridization patterns of target nucleic acid from the organism to hybridization patterns in a database.
Owner:AFFYMETRIX INC
Mycobacterial rpoB sequences
InactiveUS7108968B2Sugar derivativesMicrobiological testing/measurementBiological bodyHybridization probe
Owner:AFFYMETRIX INC
Recombinant standard plasmid for detecting anthrax bacillus, kit and construction method for the plasmid
InactiveCN102242192AStrong specificityHigh sensitivityMicrobiological testing/measurementMicroorganism based processesRpoBBiology
The invention relates to recombinant standard plasmids for detecting anthrax bacillus. The plasmid comprises a PGEM-T easy carrier and cascaded PA genes, capA genes and rpoB genes and is recorded as PGEM-T-easy-PCR. The invention further relates to a kit containing the recombinant standard plasmids. The invention also relates to a construction method for the recombinant standard plasmids, and themethod comprises the steps of designing primer pairs, amplifying sequences, constructing first intermediate plasmids, constructing second intermediate plasmids and constructing the recombinant standard plasmids. The recombinant standard plasmid PGEM-T-easy-PCR provided in the invention can be used as a substitute of a positive standard sample of anthrax bacillus (ie. nucleic acid of a virulent strain of anthrax bacillus).
Owner:中国人民解放军南京军区军事医学研究所
Drug-resistance gene film chip for detecting mycobacterium tuberculosis
InactiveCN101580879AHigh sensitivityTo achieve the purpose of detectionNucleotide librariesMicrobiological testing/measurementRpoBBiotin
A drug-resistance gene film chip for detecting mycobacterium tuberculosis is prepared by designing 54 probe spotting on a nylon film by aiming at the mutant sites of mycobacterium tuberculosis rpoB, kagG, embB, inhA, ahpC, gyrA, rrs, rpsL and pncA gene; 12 pairs of specific primers with biotin-labeled at 5' end are utilized; a sample DNA is subjected to triple PCR and amplified to form a large amount of gene fragment products with biotin; the amplified products and the probes on the film chip carry out specific hybridization; and then film washing, enzyme-linking and color reaction are carried out, thus preparing the chip. The gene film chip and the detection method thereof can detect the common gene mutations of the mycobacterium tuberculosis on the drug resistance of drugs such as isoniazid, rifampicin, streptomycin, ethambutol, pyrazinamide, quinolone and the like at one step, and are applicable to extracorporeal detection sputum sample, clinical isolation strains and mycobacterium tuberculosis multi-drug resistant gene in the organization sample.
Owner:GUANGXI MEDICAL UNIVERSITY
Method for identifying mycobacterium tuberculosis and mycobacteria other than tuberculosis, together with detecting resistance to an antituberculosis drug of mycobacteria obtained by mutation of rpob gene
The present invention provides a method for identifying Mycobacterium tuberculosis and non-tuberculosis Mycobacterium (MOTT), and for the determination of drug susceptibility of M. tuberculosis based on detection of mutations in the rpoB gene.
Owner:LEE HYEYOUNG +1
Kit used for staphylococcus aureus detection
InactiveCN110079586ALower requirementStrong specificityMicrobiological testing/measurementDNA/RNA fragmentationStaphylococcus cohniiStaphylococcus haemolyticus
The invention provides a kit used for staphylococcus aureus detection. The kit used for staphylococcus aureus detection contains guide RNA of a specific targeted staphylococcus aureus rpoB gene, an amplification primer pair, hydrated TwistAmp basic kit reaction drying balls, LbCas12a protein, a single-stranded DNA probe (ssDNA), Ribonuclease Inhibitor and buffer liquid. By using the kit for staphylococcus aureus detection, the detection specificity is high, and staphylococcus aureus and other staphylococcus, including staphylococcus epidermidis, staphylococcus hominis, staphylococcus warneri,staphylococcus capitis and staphylococcus haemolyticus, can be separated. Meanwhile, by using a RNA sequence for detection, elapsed time is about 1 hour, no PCR instruments are used, the equipment requirements are low, and are significantly lower than that of a traditional bacterial culture method or PCR sequencing method, and the clinical application valve is large.
Owner:ZHEJIANG UNIV
Diagnosis kit for mycobacterium species identification and drug-resistance detection and mfg. method thereof
InactiveCN1444662AEfficient amplificationBioreactor/fermenter combinationsBiological substance pretreatmentsHybridization probeOligonucleotide chip
The present invention relates to diagnosis kit for Mycobacterium species identification and drug-resistance detection and manufacturing method thereof, which can discriminate a Mycobacterium Tuberculosis rpoB gene point mutation relating to the Mycobacterium species identification and drug-resistance swiftly, exactly and in large quantities using an oligonucleotide chip. The diagnosis kit for Mycobacterium species identification and drug-resistance detection in accordance with the present invention consists of an oligonucleotide chip including a Mycobacterium tuberculosis complex probe, a Mycobacterium species identification probe and a drug-resistance detection probe of a Mycobacterium tuberculosis rpoB gene, and a fluorescent material containing a biotin-binding protein so as to detect hybridization of amplified products of a specimen marked as biotine and the corresponding probe.
Owner:BIOMEDLAB CORP
Composition for detection of m. tuberculosis complex or mycobacteria genus and simultaneous detection method for m. tuberculosis complex and mycobacteria genus with multiplex real time PCR using the same
Provided is a composition for detection of M. tuberculosis complex or Mycobacterium genus, comprising (i) a primer and / or probe targeting IS6110 that is an M tuberculosis complex-specific gene, (ii) a primer and / or probe targeting rpoB that is a Mycobacterium genus-specific gene, and optionally (iii) a primer and / or probe targeting a plant-derived gene as an internal control. When multiplex real-time PCR is carried out using the composition of the present invention, it is possible to detect M tuberculosis complex as well as Mycobacterium genus by a single roundPCR assay. Therefore, the present invention enables rapid and easy clinical diagnosis with high reliability.
Owner:LG LIFE SCI LTD
Tubercle bacillus drug tolerance detection reagent kit and tubercle bacillus drug tolerance detection method
PendingCN111172303AWide range of drug resistance detectionEasy constructionMicrobiological testing/measurementLibrary creationAntituberculosis drugTuberculosis bacillus
The invention provides a tubercle bacillus drug tolerance detection reagent kit and method. The tubercle bacillus drug tolerance detection reagent kit comprises a tubercle bacillus drug tolerance detection reagent, wherein the tubercle bacillus drug tolerance detection reagent comprises a sequencing primer in accordance with a tubercle bacillus drug tolerance gene; the tubercle bacillus drug tolerance gene comprises one or more genes of rpoB, katG, inhA-promoter, inhA-structural, furA, embB, ubiA, pncA, rpsA, gyrA, gyrB, eis, rpsL, rrs, tlyA, rplC and rrl; and further, the reagent kit also contains a tubercle bacillus nucleic acid detection reagent, and the tubercle bacillus nucleic acid detection reagent comprises a primer pair 1 in accordance with IS6110, a primer pair 2 in accordance with the IS6110 and a probe primer in accordance with the IS6110. Through the adoption of the tubercle bacillus drug tolerance detection reagent kit disclosed by the invention, tubercle bacillus nucleicacid in samples can be quickly detected, and positive samples can be further subjected to drug tolerance detection; and the tubercle bacillus drug tolerance detection reagent kit has good sensitivity, good specificity and good accuracy, and can perform mutation detection on 48 sites of 17 drug tolerance genes of common antituberculosis drugs and fragment deficiency detection of an intergenic region, so that the tuberculosis medication can be more accurately and comprehensively guided.
Owner:GUANGZHOU KINGMED DIAGNOSTICS GRP CO LTD +1
Primer probe group for detecting mycobacterium tuberculosis complex and rpoB mutation based on multi-enzyme isothermal rapid amplification technology and application of primer probe group
ActiveCN111057783AHigh sensitivityImprove featuresMicrobiological testing/measurementMicroorganism based processesRpoBMycobacterium
The invention relates to the technical field of molecular biology and clinical detection, in particular to a primer probe group for detecting a mycobacterium tuberculosis complex and rpoB mutations based on a multi-enzyme isothermal rapid amplification technology and application of the primer probe group. A 1296th-site base mutation of an rpoB gene is used as a molecular marker for identifying a mycobacterium tuberculosis complex strain, and a specific primer probe group is designed aiming at amino acid mutations of the 1296th-site and a 516th site, a 526th site and a 531st site of the rpoB; amethod for detecting the mycobacterium tuberculosis complex strain and the rpoB mutations based on a multi-enzyme isothermal rapid amplification technology is developed. The primer probe group disclosed by the invention is high in detection sensitivity and strong in specificity; the method has the advantages of low dependence on equipment, short detection time, realization of rapid and accurate detection, realization of visual detection in combination with a lateral flow test strip, and important application values for the infection detection of the Mycobacterium tuberculosis complex strain and the drug resistance detection of Mycobacterium tuberculosis.
Owner:ICDC CHINA CDC
Recombinant escherichia coli with high osmotic pressure resistance and application thereof
The invention relates to the field of transforming escherichia coli by virtue of genetic engineering. Specifically, the invention provides recombinant escherichia coli containing mutated rpoB, cusS and / or mreC genes. The invention also relates to an application of the recombinant escherichia coli in production of chemical raw materials including butanedioic acid and the like. The invention also provides a method for producing the chemical raw materials including butanedioic acid and the like by using the recombinant escherichia coli, and a method for improving the osmotic pressure resistance of escherichia coli by introducing the mutated rpoB, cusS and / or mreC genes.
Owner:TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Method for detecting four tuberculosis rifampicin, isoniazide and fluoroquinolones-resistant genes
InactiveCN104450877ADetermine the nature of the mutationEasy to detectMicrobiological testing/measurementLibrary creationResistant genesFluoro quinolones
The invention relates to a method for detecting four tuberculosis rifampicin, isoniazide and fluoroquinolones-resistant genes. The method comprises the following steps: designing primers capable of covering full lengths of GyrA, lnhA, katG and rpoB genes; merging the four gene primers and forming a primer pool; amplifying amplicons capable of covering full lengths of drug-resistance-related genes; establishing complete an SV-MTB library; and detecting and acquiring drug-resistant sites. By the method, multiple mutation sites of a multiple-drug-resistant strain can be detected at one time and tuberculosis patients can be scientifically, safely and accurately guided to take the medicine.
Owner:北京圣谷同创科技发展有限公司
Kit for detecting staphylococcus hominis
InactiveCN110157821ALower requirementStrong specificityMicrobiological testing/measurementMicroorganism based processesStaphylococcus haemolyticusRpoB
The invention provides a kit for detecting staphylococcus hominis. The kit comprises a guide RNA specifically targeting a staphylococcus hominis rpoB gene, amplification primer pairs, hydrated TwistAmp basic kit reaction drying balls, an LbCas12a protein, a single-stranded DNA probe (ssDNA), a Ribonuclease Inhibitor and a buffer solution. The kit is used for detecting the staphylococcus hominis, the detection specificity is high, and the staphylococcus hominis can be distinguished from other staphylococcocci including staphylococcus aureus, staphylococcus epidermidis, staphylococcus warneri, staphylococcus capitis and staphylococcus haemolyticus. The RNA sequence is used for detection, the consumed time is about 1 hour, no PCR instrument is needed, the requirements for equipment are low and significantly lower than those of a traditional bacterial culture method or PCR sequencing method, and the clinical practical value is high.
Owner:ZHEJIANG UNIV
Kit for detecting staphylococcus haemolyticus
InactiveCN110129462ALower requirementStrong specificityMicrobiological testing/measurementMicroorganism based processesStaphylococcus haemolyticusRpoB
The invention provides a kit for detecting staphylococcus haemolyticus. The kit comprises guide RNA specifically targeting staphylococcus haemolyticus rpoB gene, an amplification primer pair, hydration TwistAmp basic kit reaction drying balls, LbCas12a protein, a single-chain DNA probe (ssDNA), a Ribonuclease Inhibitor and a buffer solution. When the kit is used for detecting the staphylococcus haemolyticus, high detection specificity is achieved, and the staphylococcus haemolyticus can be distinguished from other staphylococcus such as staphylococcus aureus, staphylococcus hominis, staphylococcus warneri, staphylococcus capitis and staphylococcus epidermidis. Meanwhile, when the RNA sequence is used to perform detection, detection time is about 1 hour, a PCR instrument is not needed, equipment requirements are evidently lower than those of a traditional bacterial culture method or a PCR sequencing method, and a high clinical practical value is achieved.
Owner:ZHEJIANG UNIV
Primer for tubercle bacillus rifampicin drug-resistant fast detection and kit for tubercle bacillus rifampicin drug-resistant fast detection
InactiveCN105368939AShort detection timeImprove accuracyMicrobiological testing/measurementMicroorganism based processesRpoBMicrobiology
The invention discloses a primer for tubercle bacillus rifampicin drug-resistant fast detection and a kit for tubercle bacillus rifampicin drug-resistant fast detection. The primer comprises at least one group of following primers: the first group: rpoBForwarD: CGCCGCGATCAAGGAGTTC and rpoBReverse: GCCCGGCACGCTCATGT; the second group: rpoB-F: AGCCAGCTGAGCCAATTCAT and rpoB-R: GCCCGGCACGCTCACGT; and the third group: rpoB516-F: AGGAGTTCTTCGGCACCAG and rpoB516-R: GCACGCTCACGTGACAGAC.
Owner:SHIHEZI UNIVERSITY
Diagnostic method for rifampicin resistant mycobacterium tuberculosis
ActiveCN102304574AThe identification method is convenient and quickHigh sensitivityMicrobiological testing/measurementDNA/RNA fragmentationGenes mutationRpoB
The invention discloses a diagnostic method for rifampicin resistant mycobacterium tuberculosis. In the principle of the diagnostic method, four specific primers are designed according to the specificity of mutation loci of a mycobacterium tuberculosis rpoB gene, a deoxyribonucleic acid (DNA) template of a sample is amplified at the temperature of between 63 and 65 DEG C by using the four specific primers and DNA polymerase with strand displacement activity, the amplification efficiency can reach 109 to 1,010 copies within a short time, and color change is observed by adding SYBR Green I to determine a result. The diagnostic method has the advantages of high sensitivity, high specificity and the like, is convenient and quick, has relatively high reference value on the diagnosis and clinical administration of the rifampicin resistant mycobacterium tuberculosis, and is suitable for popularization and application.
Owner:广东省结核病控制中心 +1
Separation and application of pseudomonas with significant antagonism to plant pathogenic bacteria
The invention belongs to the field of microorganisms, and relates to separation and application of pseudomonas with significant antagonism to plant pathogenic bacteria. The strain XQ10 is separated from tobacco rhizosphere. An API 20 NE parenteral gram-negative bacillus identification result shows that XQ10 belongs to pseudomonas; 16S rRNA and multilocus sequence typing analysis based on gyrB, rpoB and rpoD show that the strain XQ10 belongs to pseudomonas but has a large difference from reported strains in pseudomonas, the strain XQ10 is regarded as a new strain which is not reported yet, and thus the strain is named Pseudomonas shandongensis XQ10. An antagonistic experiment shows that the strain has a significant inhibition effect on various plant pathogenic bacteria.
Owner:SHANDONG AGRICULTURAL UNIVERSITY
Method for identifying high-homology marine vibrios based on rpoB genes
InactiveCN105950748AThe detection method is simpleLong detection periodMicrobiological testing/measurementGenomic DNARpoB
The invention discloses a method for identifying high-homology marine vibrios based on rpoB genes. The method comprises the steps that firstly, marine vibrio rpoB gene specific primers are designed by analyzing an rpoB gene sequence between marine vibrio strains; secondly, genomic DNA of 50 marine vibrios serves as templates, a proper amplification system and proper amplification conditions are selected for PCR amplification with the primers, and marine vibrios are quickly and accurately identified with the combination of the sequencing technique. By means of the method, marine vibrios high in homology can be easily and quickly detected, the accuracy is high, and the problem that the accuracy in 16S rRNA sequencing identification at present is low is solved. The method can be used for monitoring and detecting water body and clinical samples and carrying out epidemiological investigation and evolution analysis on marine vibrios and the like, relates to the fields of clinical diagnosis, aquaculture, food safety and the like, and has profound and lasting social benefits and high economic benefits.
Owner:胡成进
Rapid source-tracking method of lactobacillus fermenti, combined sequences used for method, and construction method of combined sequences
ActiveCN106480187ARealize traceabilityMicrobiological testing/measurementDNA preparationBiotechnologyLactobacillus
The invention provides applications of combined gene sequences comprising lactobacillus fermenti genomes in source tracking of lactobacillus fermenti. The combined gene sequences comprise six house-keeping genes, namely, dna A, pyrG, rpoB, recA, dnaK and murC. The invention further provides a rapid source-tracking method of lactobacillus fermenti. The rapid source-tracking method comprises the following steps: (1) extracting genome DNA of lactobacillus fermenti; (2) constructing the combined gene sequences of the bacterial strains; (3) constructing adjacent method phylogenetic trees for the combined gene sequences by adopting MEGA 6.0 software, thus obtaining the source-tracking analysis for the lactobacillus fermenti strains through the phylogenetic trees; and (4) judging the bacterial strains in the same branch in the phylogenetic trees as the same resource. With the method, the bacterial strains with different resources can be effectively and rapidly separated, so that the source tracking for lactobacillus fermenti is realized, and the phylogenetic tree relationship of the lactobacillus fermenti strains with different resources is determined.
Owner:完美(广东)日用品有限公司
Reagent kit for detecting enterobacter aerogenes
InactiveCN110241237AStrong specificityLow equipment requirementsMicrobiological testing/measurementAgainst vector-borne diseasesRpoBSingle strand dna
The invention provides a reagent kit for detecting enterobacter aerogenes. The reagent kit contains a guide RNA specifically targeted to an enterobacter aerogenes rpoB gene, an amplification primer pair, a hydration TwistAmp basic kit reaction drying ball, LbCas12a protein, a single-stranded DNA probe (ssDNA), a Ribonuclease inhibitor and a buffer solution. When the reagent kit is used for detecting the enterobacter aerogenes, the detection specificity is high, and the enterobacter aerogenes can be distinguished from other enterobacter bacteria including enterobacter cloacae, enterobacter gergoviae and enterobacter sakazakii. Besides, when the RNA sequence is used for detection, time consumption is about 1 hour, a PCR instrument is not needed, requirements for equipment are low and are notably lower than those by a traditional bacteria culture method or a PCR sequencing method, and the clinical use value is high.
Owner:ZHEJIANG UNIV
Visualized detection probes and application thereof in tuberculosis rifampicin resistance mutation detection
InactiveCN102732610AEasy to distinguishMeet different testing needsMicrobiological testing/measurementDNA/RNA fragmentationMutation detectionRpoB
The invention discloses novel visualized fast and sensitive detection probes and applications thereof in mycobacterium tuberculosis rifampicin resistance mutation detections. The visualized probes provided by the invention comprise: a common anchoring probe A, insulation probes L and R, mutation detection probes B, and a common competition probe SIB. The mutation detection probes B and the probe SIB have a same target DNA complementary region, and only the base types of the mutation sites are different. Aims at rifampicin resistance mutation, a detection probe cluster is designed and synthesized according to all the mutation sites included in a mycobacterium tuberculosis rifampicin resistance rpoB genetic mutation core. The probe cluster comprises 8 probe sets, wherein each probe set comprises a specific mutation detection probe B. With the method provided by the invention, the designed probe sets and probe clusters have good distinguishing ability upon synthesized wild-type and mutant detection fragments, and can be used for accurately detecting specific mutation sites of 530-533 site amino acids of the mycobacterium tuberculosis rifampicin resistance rpoB gene.
Owner:章晓联
Method for realizing multi-site sequence molecular typing on haemophilus parasuis
InactiveCN108642192AFast and efficient result feedbackImproved Breeding StrategiesMicrobiological testing/measurementMicroorganism based processesMulti siteGenetic diversity
The invention discloses a method for realizing multi-site sequence molecular typing on haemophilus parasuis. According to the method, the operation technology of carrying out molecular typing on the haemophilus parasuis by adopting the multi-site sequence typing (MLST) method is disclosed for the first time. In the method, the genome DNA of the pathogenic bacteria is extracted, 7 house-keeping genes including rpoB, atpD, g3pd, infB, mdh, _6pgd and frdB are adopted for carrying out screening, amplification, detection and sequencing, CExpress and DNAMAN software is adopted for carrying out splicing, multi-sequence alignment and analysis on the sequencing result, and then the sequence type (ST) of the strain is obtained through an on-line haemophilus parasuis MLST typing database. The amplification primers used by the typing technology are adopted for the first time, the PCR reaction system and conditions automatically optimized, and the technique process can be used for the classification identification and genetic diversity research of haemophilus parasuis.
Owner:SOUTH CHINA UNIV OF TECH
Mycobacterium tuberculosis rifampin-resistance mutation visual detection probes and application thereof
InactiveCN102628086AEasy to distinguishMeet different testing needsMicrobiological testing/measurementDNA/RNA fragmentationWild typeRifampin resistance
The invention discloses mycobacterium tuberculosis rifampin-resistance mutation visual detection probes and an application thereof. For rifampin-resistant mutation, mycobacterium tuberculosis rifampin-resistant rpoB gene mutation core region 510-524 amino acids are divided into three regions; three detection probe clusters are designed and synthesized based on all mutation sites included in every region; each probe cluster includes several probe sets, each probe set comprises specific mutation detection B probes. Various probe sets and probe clusters designed in the invention have great discrimination performance for synthesized wild-type and mutant-type detection fragments, can accurately detect the specific mutation sites of the rifampin-resistant mycobacterium tuberculosis rpoB gene mutation core region 510-524 amino acids and have a good application prospect.
Owner:WUHAN UNIV
rpoB gene fragments and a method for the diagnosis and identification of Mycobacterium tuberculosis and non-tuberculosis Mycobacterial strains
The present invention is related to rpoB gene fragments and method for the diagnosis and identification of Mycobacterium tuberculosis and non-lubercuolsis Mycobacterial strains using rpoB gene and it's fragments.
Owner:SANG NAE CHO +1
Separation, identification and applications of bacterial cellulose production strain
ActiveCN107488607AFast film productionEasy to get materialsBacteriaMicrobiological testing/measurementMicroorganismHousekeeping gene
The invention belongs to the technical field of microorganisms, and particularly relates to separation, identification and applications of a bacterial cellulose production strain, wherein the strain is isolated from corrupted fruits, and has characteristics of rapid film production and high film yield. According to the present invention, the isolated HEC-004 strain is subjected to molecular level identification by comprehensively using 16S rDNA and 3 housekeeping genes such as dnaK, groEL and rpoB, and the results determine that the isolated strain is Gluconacetobacter nataicola, is preserved in the China general microbiological culture collection center, and has the preservation number of CGMCC No.11588.
Owner:HEC PHARMA CO LTD
Compositions and methods for detection of drug resistant mycobacterium tuberculosis
Owner:F HOFFMANN LA ROCHE & CO AG
Screening and application of burkholderia gladioli real-time quantitative polymerase chain reaction (PCR) reference genes and primers thereof
ActiveCN111705149AImprove stabilityWide adaptabilityMicrobiological testing/measurementMicroorganism based processesReference genesCandidate Gene Association Study
The invention discloses screening and application of burkholderia gladioli real-time quantitative polymerase chain reaction (qRT-PCR) reference genes and primers thereof. According to obtained transcriptome analysis results and reported reference genes, 12 candidate reference genes with relatively stable expression are preliminarily screened, and gene names are shown as follows: atpD, clpP, clpX,ftsZ, gyrB, lpxC, pyrG, recA, rpoB , rpoD, thyA and 16S; for the candidate genes, amplification primers are designed; reference genes under different culture conditions (temperature, initial pH valueof medium, culture time, treatment with NaCl different in concentration) of burkholderia gladioli are screened; geNorm, NormFinder and Bestkeeper software is employed to analyze qRT-PCR results; and finally, the reference genes with most stable expression under different culture conditions and NaCl treatment condition are obtained by screening. The invention is beneficial to the stability and reliability of analysis and study of gene expression of the burkholderia gladioli under different conditions.
Owner:INST OF BOTANY JIANGSU PROVINCE & CHINESE ACADEMY OF SCI
MTB (mycobacterium tuberculosis) rpoB mutant gene and application thereof
PendingCN105331623AEasy to measureRapid determinationMicrobiological testing/measurementMicroorganism based processesRpoBResistant tuberculosis
The invention discloses an MTB (mycobacterium tuberculosis) rpoB mutant gene and an application thereof. Compared with a normal rpoB gene, the mutant gene has a c.1843G>A mutation site; a candidate gene screening method is adopted to detect 33 rifampicin-resistant tuberculosis strains in China, the gene mutation site is found for the first time, and the rpoB gene c.1843G>A mutation site in the rifampicin-resistant tuberculosis strains has certain occurrence frequency, so that the rpoB gene c.1843G>A mutation site can be taken as diagnostic basis of drug-resistance molecular mechanisms of rifampicin-resistant strains clinically.
Owner:KUNMING UNIV OF SCI & TECH
PCR-ELISA based method for detecting mycobacterium tuberculosis resistance gene
Owner:SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
Mycobacterium tuberculosis rifampicin and isoniazide drug-resistant mutation detection kit and method
InactiveCN112941210AMicrobiological testing/measurementMicroorganism based processesRpoBMycobacterium
The invention provides a mycobacterium tuberculosis rifampicin and isoniazide drug-resistant mutation detection kit and method, and particularly discloses a method and kit for detecting mycobacterium tuberculosis rifampicin and isoniazide drug-resistant mutation based on a fluorescent PCR melting curve method. The method and kit can be used for rapidly and qualitatively detecting drug-resistant mutations of drug-resistant determining regions of rifampicin drug-resistant genes rpoB and isoniazide drug-resistant genes katG, inhA and ahpC in a positive sputum culture sample of a mycobacterium tuberculosis complex of a tuberculosis patient in vitro.
Owner:DAAN GENE CO LTD
Who we serve
- R&D Engineer
- R&D Manager
- IP Professional
Why Eureka
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Social media
Eureka Blog
Learn More Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com