Primer for tubercle bacillus rifampicin drug-resistant fast detection and kit for tubercle bacillus rifampicin drug-resistant fast detection
A technology of Mycobacterium tuberculosis and reagent kits, applied in the field of molecular biology, can solve problems affecting detection specificity and achieve high accuracy, low cost, and easy promotion
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1: refer to figure 1 , is the experimental result of Example 1 of the present invention.
[0032] The experimental plan is as follows:
[0033] 1. Test method:
[0034] (1) Use an inoculation loop to scrape the bacteria that grow well on the modified Roche medium, put them into the EP tube with TEbuffer, and inactivate them in a metal bath at 85°C for 45 minutes.
[0035] (2) Extract the DNA of various strains according to the instructions of the column Mycobacterium DNAout kit.
[0036] (3) Measure the DNA concentration and dilute to 10ug / ml according to different concentrations.
[0037] Reaction system: total volume 10ul (HRMMix: 5ul; MgCl 2 : 1.2ul; H 2 O: 2.3ul; the first set of primers:
[0038] rpoBForwarD: CGCCGCGATCAAGGAGTTC and rpoBReverse: 0.5ul each of GCCCGGCACGCTCATGT; DNA template: 1ul)
[0039] Reaction parameters: pre-denaturation at 95°C for 10min; denaturation at 95°C for 10s; annealing at 62°C for 15s; sectarget at 53°C; extensio...
Embodiment 2
[0044] Embodiment 2: refer to figure 2 , is the experimental result of Example 2 of the present invention.
[0045] The experimental plan is as follows:
[0046] 1. Test method:
[0047] (1) Use an inoculation loop to scrape the bacteria that grow well on the modified Roche medium, put them into the EP tube with TEbuffer, and inactivate them in a metal bath at 85°C for 45 minutes.
[0048] (2) Extract the DNA of various strains according to the instructions of the column Mycobacterium DNAout kit.
[0049] (3) Measure the DNA concentration and dilute to 10ug / ml according to different concentrations.
[0050] Reaction system: total volume 10ul (HRMMix: 5ul; MgCl 2 : 1.2ul; H 2 O: 2.3ul; the second set of primers:
[0051] rpoB-F: AGCCAGCTGAGCCAATTCAT and rpoB-R: 0.5ul each of GCCCGGCACGCTCACGT; DNA template: 1ul)
[0052] Reaction parameters: pre-denaturation at 95°C for 10min; denaturation at 95°C for 10s; annealing at 62°C for 15s; sectarget at 53°C; extension at 72°...
Embodiment 3
[0057] Embodiment 3: refer to image 3 , is the experimental result of Example 3 of the present invention.
[0058] The experimental plan is as follows:
[0059] 1. Test method:
[0060] (1) Use an inoculation loop to scrape the bacteria that grow well on the modified Roche medium, put them into the EP tube with TEbuffer, and inactivate them in a metal bath at 85°C for 45 minutes.
[0061] (2) Extract the DNA of various strains according to the instructions of the column Mycobacterium DNAout kit.
[0062] (3) Measure the DNA concentration and dilute to 10ug / ml according to different concentrations.
[0063] Reaction system: total volume 10ul (HRMMix: 5ul; MgCl 2 : 1.2ul; H 2 O: 2.3ul; the third set of primers: rpoB516-F: AGGAGTTCTTCGGCACCAG and rpoB516-R: 0.5ul each of GCACGCTCACGTGACAGAC; DNA template: 1ul)
[0064] Reaction parameters: pre-denaturation at 95°C for 10min; denaturation at 95°C for 10s; annealing at 62°C for 15s; sectarget at 53°C; extension at 72°C for 1...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap