65 results about "Rice stripe virus" patented technology

The invention relates to an application of plant eIF4A genes in preparation of rice stripe virus infection resistant rice. According to the invention, a binary expression vector is constructed by utilizing the plant eIF4A genes and vsiRNA binding site mutants thereof; rice and nicotiana benthamiana are successfully converted; and a rice stripe virus infection resistant transgenic plant is obtained. Experimental results show that the tolerance of the plant body to rice stripe virus can be obtained through expression of the plant eIF4A genes or the vsiRNA binding site mutants thereof in the plant body.

The invention provides a pesticide composition, and in particular relates to an active pesticide composition, compounding one or more of toxic fluoride phosphate, the weight ratio of toxic fluoride phosphate to other active substances is 30:0.15 to 3.3:30, and the content of effective components by weight is 1%-90%. The compound composition can be processed into water dispersible powder, suspending agent, microemulsion, aqueous emulsion, water dispersible granule, dry suspension emulsion and seed coating agent and the like, after accessory ingredient or carrying agent is added. The composition can be used to prevent and treat virus diseases caused by rice stripe virus, rice dwarf virus, maze rough dwarf virus, rice black-streaked dwarf virus, tomato virus, cucumber mosaic virus and tobacco mosaic virus, and has the beneficial effects of enhanced effect, concurrent treatment, postponed pesticide resistance, decreased dosage of toxic fluoride phosphate and reduced cost.

A multiple substituted pyrido(4,3-d) pyrimidine with bactericidal and herbicidal activity and its production are disclosed. In structural formula, R is alkyl or substituted alkyl or alkenyl or alkyl, heterocyclic substituted alkyl, fused heterocycle substituted alkyl, hydroxy-alkyl, phenyl alkyl or substituted phenyl alkyl, substituted or non-substituted phenoxy-acetylamino or phenoxy-propionamido. It can be used as inhibitor and bactericide for cotton wilt mould, rice stripe virus, or cucumber mildew or wheat mildew.

The invention discloses a hybridoma cell strain secreting a monoclonal antibody against a barley yellow dwarf virus GAV strain, and an application of the monoclonal antibody thereof. A BALB / c mouse is immunized with barley yellow dwarf virus (BYDV) GAV strain virions which is used as antigens and is purified by a differential centrifugation method, and a hybridoma cell strain 27E1 which can be subcultured stably and secretes a monoclonal antibody against BYDV GAV is obtained through cell fusion, screening, and cloning, and the accession number is CGMCC No. 8781. The monoclonal antibody secreted by the hybridoma cell has an ascetic ELISA titer of more than 10<-6>, and the antibody type and subtype are IgG1, kappa chain. A specific reaction can be carried out between the monoclonal antibody secreted by the hybridoma cell strain 27E1 and the barley yellow dwarf virus GAV strain, but the monoclonal antibody does not react with rice stripe virus, rice ragged stunt virus, Chinese wheat mosaic virus, wheat yellow mosaic virus, barley yellow mosaic virus, barley yellow dwarf virus GPV strains and PAV strains. The hybridoma cell strain 27E1 and the secreted monoclonal antibody provide technical and material support for the diagnosis, detection and scientific prevention and control of wheat viral diseases.

The invention relates to RNA (Ribonucleic Acid) interference carriers of RSV (Rice Stripe Virus) and RBSDV (Rice Black-Streaked Dwarf Virus) as well as a construction method and application thereof, belonging to the technical field of biology. The invention establishes RNA interference carriers pMCG161+ / -D and pCMBIA1301+ / -D of the RSV by using sequences shown as SEQ ID NO1. The invention provides an interference virus gene expression carrier for plant disease-resistant gene engineering as well as a construction method and application thereof and provides a new concept for the application of a transgenic technology and RNA interference in biological resistant breeding. By transplanting the carrier to rice, a virus-resistant plant is successfully acquired, the expected target of obtaining a RSV and RBSDV-resistant rice new material according to the principle of RNA interference is realized, a successful example is provided for plant resistant breeding and gene engineering of RNA interference mediums and the blank of researches on the RSV and RBSDV resistance of the RNA interference mediums in the field is made up.

Wherein, building a DIPA detection method with the RSV specific monoclonal antibody, and hereby building the reagent box with main reagent provided as working liquid or condensed liquid. This invention can detect whether there is RSV rapidly, and has wide application.

The invention discloses epsilon-polylysine-containing pesticidal composition for controlling plant virus diseases. The epsilon-polylysine-containing pesticidal composition comprises components as follows: epsilon-polylysine, glycine, cytosintetidemycin and filler. The pesticidal composition has the advantages as follows: 1, after epsilon-polylysine, glycine and cytosintetidemycin are mixed in a certain ratio, the antiviral synergism is remarkable; 2, the disease prevention spectrum is broad, and the pesticidal composition has obvious control effect on multiple virus diseases such as rice stripe virus, cucumber mosaic virus, tobacco mosaic virus and the like of multiple host plants; 3, the plants are induced to produce immunity, defense capability of the plants can be utilized sufficiently,use of chemical pesticides and risk of pesticide resistance generation are reduced, ecological environment is protected, and requirements of green plant protection and ecological civilization construction are met.

The invention discloses a method of controlling rice stripe virus propagation. The method of controlling rice stripe virus propagation concretely includes the following step that rice stripe virus propagation is controlled by inhibiting activation of the JNK signal channel of rice stripe virus amboceptor insects. The result displays RSV regulation and regulates the JNK signal channel to increase virus copy. Activation of the JNK channel is inhibited by regulating several important genes of the JNK channel, and RSV virus propagation can be effectively controlled. A new strategy is provided for prevention and control of plant RSV viruses.

The invention provides a method for quickly and synchronously detecting rice stripe virus (RSV) and rice black-streaked dwarf virus (RBSDV) in an insect vector laodelphax striatellus, and belongs to the field of plant protection. According to nucleotide sequences of the rice stripe virus RNA4 and the rice black-streaked dwarf virus S2, three primers are designed as follows: [A] RS-F, [B] RB-F, and [C] RSRB-R, wherein A and C are combined to detect the rice stripe virus; the B and C are combined to detect the rice black-streaked dwarf virus. After extracting total RNA of single laodelphax striatellus, only one RT-PCR is needed, so that the rice stripe virus and the rice black-streaked dwarf virus can be detected, and thus, and quick and synchronous detection for the two viruses in the laodelphax striatellus is realized. Compared with the conventional method for detecting one virus by virtue of one RT-PCR, the cost is greatly saved and the time is saved, and thus, the method is a quick, simple, flexible and specific detecting method. The method disclosed by the invention can be applied to monitoring work of a virus carried rate of a field laodelphax striatellus colony, and can also be applied to related research work of a virus and vector interaction mechanism.

The present invention discloses monoclonal antibody of rice stripe virus (RSV) and its immunodetecting method. Specific monoclonal antibody of RSV is used as tool in establishing immunodetecting method for RSV in rice and RSV propagating insect. The specific process includes: immunizing bal b / c mouse with purified RSV to prepare hybridoma cell, specifically screening hybridoma with positive culture supernatant to obtain four monoclonal antibody strains of specifically resisting RSV, and establishing direct / indirect ELISA detection method with these monoclonal antibodies. The establishment and application of the said method makes it possible to detect rice disease sample and insect with RSV conveniently, accurately and fast.

The invention provides a preparation method of an active substance capable of inhibiting plant viruses and plant bacteria and application of the active substance. The preparation method of the active substance capable of inhibiting plant viruses and plant bacteria comprises that folium artemisiae argyi in Guizhou province is taken as raw material, dried in the sun and then smashed, ethanol extraction is carried out; ethanol extract is extracted by virtue of trichloromethane; reduced pressure concentration is carried out on a trichloromethane extraction layer, so that crude extract is obtained; silica column chromatography is carried out on trichloromethane crude extract, gradient elution is carried out by virtue of petroleum ether-acetic acid ethyl ester mixed eluant in different ratios, then purification means like the silica column chromatography is carried out for a plurality of times, and two monomer compounds, namely 8 alpha-hydroxyl artemisia terpene and 5,4'-dihydroxyl-6,7,3'-trimethoxy flavone, are obtained. Biological activity tests show that the monomer compound I has good prevention and control effect on plant viruses such as cucumber mosaic virus, tobacco mosaic virus, south rice black-streaked dwarf virus and rice stripe virus and 5,4'-dihydroxyl-6,7,3'-trimethoxy flavone has good inhibiting effect on bacterial disease pathogenic bacteria such as tomato bacterial wilt, tobacco bacterial wilt, rice bacterial leaf blight and rice bacterial leaf streak.

The invention relates to molecular markers of a rice stripe virus disease-resistant major gene locus qSTV11, which belongs to the field of molecular genetics. The molecular markers are obtained by the following steps of: hybridizing a rice variety Nipponbare serving as a female parent with kasalath serving as a male parent; performing back crossing on a hybrid product and the Nipponbare; deriving to obtain a back crossing recombinant inbred line; performing genetic linkage analysis on the genotype of each family and corresponding disease index ratio; detecting the stripe virus disease-resistant major gene locus qSTV11, wherein alleles from kasalath have resistance effects; and screening to obtain molecular markers R21, R22, R13 and R48 which can be bred and utilized. The four molecular markers are used for detecting whether the kasalath and a derivative variety (line) contain the major gene locus or not, so that the rice stripe virus disease resistance level can be predicted and the selection efficiency of a stripe virus disease-resistant rice variety is improved remarkably.

The invention provides a method for detecting rice stripe virus in single-head laodelphax striatellus through dot-ELISA (dot-enzyme-linked immuno sorbent assay), and belongs to the field of plant protection. According to the method, after laodelphax striatellus is collected and ground, and a dot-ELISA system for detecting the rice stripe virus carried by single-head mediator laodelphax striatellus is established by monoclonal antibody of the rice stripe virus. The detection method is high in sensitivity and specificity, is suitable for large-batch single-head laodelphax striatellus sample detection, does not require special instruments and equipment, has the characteristics that the result is simple and easy to determine, the detection result is convenient to store for a long time and the like, can be used for performing large-scale survey and detection on the virus carried rate of the rice stripe virus carried by field laodelphax striatellus, and provides technical support for prediction of outbreaks of the field rice stripe disease and adoption of corresponding prevention and control measures .

The invention discloses a method and an artificial feed for enabling laodelphax striatellus to obtain rice stripe viruses. The method for enabling rice stripe viruses to obtain laodelphax striatellus comprises the following step: feeding the laodelphax striatellus with the artificial feed containing rice stripe viruses, thereby enabling the laodelphax striatellus to obtain rice stripe viruses. The composition of the artificial feed is that every 1 muL of the artificial feed contains the rice stripe viruses greater than or equal to 300ng, the balance being a sucrose aqueous solution with concentration being 50g / L. According to the method, the rice stripe virus acquiring rate is higher than 90% which is greatly increased in comparison with that of a conventional method of feeding non-toxic ash-free plant hoppers by toxic rice plants. According to the method, an experimental platform for enabling the laodelphax striatellus to obtain toxin efficiently is established, and the research on the transmission mechanism of rice stripe viruses in the laodelphax striatellus is strongly promoted, and the effective progress of the novel disease-resistant strategy of removing virus in insects is promoted.

The invention relates to an anti-plant-virus preparation and a preparation method thereof, in particular to an anti-virus preparation containing coriolus versicolor glycopeptide and a preparation method thereof. The invention discloses a coriolus versicolor glycopeptide antiviral preparation and a preparation method thereof. The antiviral preparation is prepared from the following raw materials inpercentage by weight: 8%-10% of coriolus versicolor glycopeptide, 3%-5% of a surfactant, 2%-3% of a stabilizer, 0.3%-0.5% of a preservative, 2%-3% of an antifreeze preparation and the balance of water, wherein the sum of the weight percentages of all the raw materials is 100%. The coriolus versicolor glycopeptide preparation has prevention and treatment effects on various plant virus diseases, such as tobacco mosaic virus diseases, wheat yellow dwarf virus diseases or rice stripe virus diseases. In addition, the coriolus versicolor glycopeptide has no toxic effect on human, livestock and ecological environment, and is an ideal biopesticide for developing green and organic agriculture.

The invention discloses a reference gene composition for rice stripe virus (RSV)-infected plant gene function analysis. Expression stability of fluorescent quantitative PCR candidate reference genes in the RSV-infected plant is analyzed by geNorm and NormFinder, a paired difference V value of a normalized factor is computed by geNorm program after introduction of a novel reference gene, and the most suitable reference gene composition is determined according to V value change so that the optimal reference gene composition of UBQ10 and GAPDH for RSV-infected plant gene function analysis is obtained. RSV-infected rice plant is used as an object, and compared with a single reference, the reference gene composition of UBQ10 and GAPDH can produce an accurate and reliable gene expression result. The reference gene composition can be used for research on an expression level and functions of RSV-infected rice related genes and a RSV invasion mode.

The invention discloses application of a hybridoma cell line for secreting a monoclonal antibody resisting rice strip mosaic virus (RSMV) and the monoclonal antibody of the hybridoma cell line. The purified RSMV is an antigen immune BALB / c mouse; a hybridoma cell line 1D4 which can stably pass and secrete the monoclonal antibody resisting the RSMV is obtained by cell fusion, screening and colonizing, and the preservation number of the hybridoma cell line 1D4 is CGMCC (China General Microbiological Culture) No.14898. The ascites indirect ELISA (Enzyme Lined Immunosorbent Assay) titer of the monoclonal antibody secreted by the hybridoma cell reaches 10<-10>, and the type and subclass of the antibody are IgG1 and kappa chains. The monoclonal antibody has specific reaction with N protein of the RSMV. An ACP-ELISA method and a dot-ELISA method for detecting the RSMV are established by taking the 1D4 as a core; the sensitivities of the two methods for detecting disease leaves respectively reach the dilution of 1 to 2621440 and the dilution of 1 to 40960 (w / v, g / mL). The obtaining of the hybridoma cell line and the monoclonal antibody thereof and establishment of a serological testing method provide material and technical support for detection and diagnosis and scientific prevention and control of virus disease.

The present application discloses an application of OsAO gene for improving rice resistance to rice stripe disease, rice black-streaked dwarf disease or other rice or corn virus diseases caused by homologous virus of rice black-streaked dwarf virus. The present application also provides an application of OsAO gene, the protein encoded by the gene or a recombinant vector containing the gene in regulating plant resistance to rice stripe disease, rice black-streaked dwarf disease or other rice and corn virus diseases caused by homologous virus of rice black-streaked dwarf virus, said protein has the amino acid sequence as shown in Seq 4. The experiment proved that the plant disease resistance is increased in rice overexpressing OsAO gene, indicating that the OsAO protein encoded by this gene plays an important role in rice resistance to rice stripe disease and rice black-streaked dwarf disease.

The invention provides a vaccination method for a peanut stripe virus and belongs to the technical field of plant virus vaccination. By means of the method, vaccination of the peanut stripe virus canbe simply and efficiently finished. According to the technical scheme, the step of spraying carborundum on a plant before vaccination is omitted, and the carborundum together with virus leaves and phosphate buffer is prepared into homogenate, so that efficient vaccination can be finished with small amount of virus leaves. The method has the advantages that vaccination speed and vaccination efficiency of the peanut stripe virus are improved, the resistance of peanuts to the stripe virus is favorably identified quickly and efficiently, and disease-resisting breeding selection and viral pathogenesis research are accelerated.

The present invention relates to the new use of zymosan for anti-plant virus, especially relates to the use of zymosan to prepare medicine with anti-virus effect. The zymosan involved in the present invention has control effects on various plant virus diseases, such as tobacco mosaic virus disease, wheat yellow dwarf virus disease or rice stripe leaf blight virus disease and the like. The zymosan of the present invention can be prepared into a pharmaceutical composition by a method known in the prior art, and any pesticide pharmaceutically acceptable dosage form, such as water, soluble liquid, emulsifiable concentrate, microemulsion, suspension, emulsion in water, Wettable powder or water dispersible granule pharmaceutical composition, etc. In addition, zymosan has no toxic effects on humans, animals and the ecological environment, and is an ideal biological pesticide for the development of green and organic agriculture.

The invention provides a preparation method and application of a polyclonal antibody of a rice stripe virus nucleocapsid protein, and belongs to the technical field of rice stripe virus detection. Thepolyclonal antibody of the rice stripe virus nucleocapsid protein CP is obtained by immunizing animals with the rice stripe virus nucleocapsid protein CP as immunogen; and the amino acid sequence ofthe rice stripe virus nucleocapsid protein CP is as shown in SEQ ID No. 1. The polyclonal antibody of the rice stripe virus nucleocapsid protein has the characteristics of low cost, wide application range, multiple audiences, high sensitivity, and the like, and can be used for multiple biological detection experiments such as an immune spot determination method, an enzyme-linked immunosorbent assay method, a protein immunoblotting method, an immuno-fluorescence method, an immuno-electron microscopy method, and the like. By utilizing the disclosed polyclonal antibody, disease early warning is carried out through small brown rice plant hoppers at the beginning of outbreak of rice stripe disease, and multi-means disease monitoring is facilitated.

The invention relates to application of a p3 gene of a rice stripe virus (RSV) in the preparation of a transgenic rice-blast-resistant frond. The application is characterized in that the nucleotide sequence of the gene is presented by SEQ ID NO:1; the gene is derived from the rice stripe virus and is produced by amplifying a sequence on a diseased rice strain collected from a farm by comparing and designing a primer through a GenBank sequence. Preferably, the gene is used for preparing rice-blast-resistant rice. The application has the advantages that (1) currently, most rice-blast-resistant genes are rice endogenous genes, and being a viral protein, the p3 gene can improve the bacterial blight resistance of the rice and enrich the rice-blast-resistant gene resources; (2) as the p3 gene is not a rice endogenous resistance gene, the resistance mechanism of the p3 gene is different from the resistance mechanisms of the other resistance genes and can help people to understand rice-blast-resistant bacteria mechanisms and rice blast bacteria pathogenesis of the rice.

The invention relates to a qPCR (quantitative polymerase chain reaction) primer for detecting NS2 genes of rice stripe viruses and a detection method of the qPCR primer. The sequence of the primer includes ATCAACAGACGGAGCATC for NS2-qPCRF and GATTGGTTACAACTATGTGCTT for NS2-qPCRR. GC content of the primer is 36-50%, amplified fragments are 107bp, specificity is high, primer dimers do not exist, standard curves corresponding to the premier meet the requirements of the qPCR premier, and accordingly, the qPCR primer is quite suitable for detection of corresponding target gene expression quantity of the primer.

The invention relates to application of a p3 gene of a rice stripe virus in the preparation of a transgenic bacterial-blight-resistant frond. According to the application, the p3 gene of the rice stripe virus is utilized for constructing a binary expression vector to successfully transform rice so as to obtain a bacterial-blight-resistant transgenic plant. An experimental result shows that the p3 gene expresses in a regenerated frond and proves that a regenerated plant has very strong bacterial blight resistance. Currently, most bacterial-blight-resistant genes are rice endogenous genes; being a viral protein, the p3 gene improves the bacterial blight resistance of the rice, enriches the gene resources of the bacterial blight and has important theoretical and practical significances on cultivation of the rice with high bacterial blight resistance.

The invention relates to a rice stripe virus RNA interference vector, a constructing method and application thereof, belonging to the technical field of biology. The method establishes the rice stripe virus RNA interference vector pMCG161+ / -R and pCMBIA1301+ / -R by using a sequence shown in SEQ ID NO 3 as sense and antisense strands. The invention provides the vector interfering with virus gene expression and the constructing method and application thereof for genetic engineering of plant disease resistance, and provides a new idea for transgenic technology and application of RNA interference in biological resistance breeding. The vector is transferred into paddy to obtain antivirus plant successfully, the preset target of obtaining the anti RSV paddy new material by using RNA interference principle can be realized, a successful case is provided for RNA interference mediated plant resistance breeding and genetic engineering, and the blank of RNA interference mediated RSV resistance in the research of the field can be filled up.

The invention discloses a pesticide composition for preventing and curing plant virus diseases. The effective components of the pesticide composition comprise ellagic acid, copper sulfate, zinc sulfate and magnesium sulfate. Antiviral synergism is notable when ellagic acid, copper sulfate, zinc sulfate and magnesium sulfate are mixed in a certain proportion. The pesticide composition has a wide disease preventing spectrum, has notable preventing and curing effects on a plurality of virus diseases of a plurality of host plants, wherein the virus diseases comprise tobacco mosaic virus, cucumber mosaic virus, rice stripe virus and the like. The pesticide composition can induce plants to have immunity, can fully use self defensive abilities of plants, reduce the use of chemical pesticides and the risks generated by pesticide resistance, protect the ecological environment, and meets the requirements of green plant protection and ecological civilization construction.

The invention discloses a colloidal gold immunity test strip for rapidly detecting a rice stripe virus (RSV) and a preparation method. According to the invention, an anti-RSV monoclonal antibody is labeled by colloidal gold into a gold-labeled antibody, the monoclonal antibody is wrapped by a combination pad made of a polyester film, another anti-RSV monoclonal antibody and goat anti-mouse IgG arecombined on a detection line (T line) and a quality control line (C line) of a nitrocellulose membrane respectively, and then a sample pad made of water absorbing filter paper, an RSV immune colloidal gold pad, the nitrocellulose membrane combined with the RSV monoclonal antibody 11C1 and the goat anti-mouse IgG and the water absorbing paper are sequentially pasted on a PVC rubber slab, so that the test strip is prepared. The test strip can detect the RSV in field rice and single Laodelphax striatellus samples accurately, specially and sensitively. According to the test strip, people can directly observe a detection result with the naked eyes within 3-5min. The test strip is suitable for detecting large samples in the field, and provides technical and material support for the diagnosis, early monitoring and early warning, disease resistance breeding, epidemiological research and scientific prevention and control of rice stripe diseases.

The invention relates to a new application of F01 polysaccharide for resisting viruses, in particular to an application of the F01 polysaccharide in preparing a medicine with an antiviral effect. TheF01 polysaccharide disclosed by the invention has prevention and treatment effects on various plant virus diseases, such as tobacco mosaic virus diseases, wheat yellow dwarf virus diseases or rice stripe virus diseases. The F01 polysaccharide disclosed by the invention can be prepared into a pharmaceutical composition and any pesticide acceptable dosage form, such as an aqueous solution, a solubleliquid, missible oil, a microemulsion, a suspending agent, an emulsion in water, wettable powder or a water dispersible granule pharmaceutical composition, by adopting a known method in the prior art. In addition, the F01 polysaccharide has no toxic effect on human, livestock and ecological environment, and is an ideal biopesticide for developing green and organic agriculture.