Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

44 results about "Puccinia graminis tritici" patented technology

Penconazole and zhongshengmycin-containing sterilization composition and application thereof

The invention relates to the field of pesticide compounding techniques, particularly relates to a penconazole and zhongshengmycin-containing sterilization composition, and also relates to an application thereof. The penconazole and zhongshengmycin-containing sterilization composition comprises effective ingredients of penconazole and zhongshengmycin with a weight part ratio of (90:1)-(1:90), and the penconazole and zhongshengmycin-containing sterilization composition is prepared into a wettable powder, a suspending agent, an emulsion in water, a water dispersible granule, emulsifiable concentrate and the like after being added with assistants and an excipient, and is used for controlling fungal diseases caused by germs such as erysiphe, uromyces, mortierella, septoria and venturia and bacterial diseases caused by germs such as Gram-positive bacteria, Gram-negative bacteria, mycobacteria and saccharomycetes. The penconazole and zhongshengmycin-containing sterilization composition has a relatively good synergism within a certain range, is superior to a single preparation on the aspect of control effects, is relatively durable in pesticide effect, has a special effect on controlling powdery mildew, rust diseases, scab, leaf spot diseases, gray mold, white rot, soft rot, streak diseases, rice blast, ring spot, gibberellic diseases and bacterial diseases, is relatively low in residue, is relatively easily decomposed after a lasting period, is relatively environment-friendly, and is beneficial to the increase of yield and income in an agricultural district.
Owner:江西绿川生物科技实业有限公司

Molecular detection method for rapid detection of new puccnia striiformis West f.sp.tritici strain

The invention discloses a molecular detection method for rapid detection of new toxic strain V26 of puccnia striiformis West f.sp.tritici; by a large number of screening, a specific marker of the new toxic strain V26 of the puccnia striiformis West f.sp.tritici is obtained, the specific marker is sequenced, and according to sequencing results, a pair of specific primers comprising V26SP1:5'CTGTAAAGCGGATAAAGGAA 3', and V26SP2:5'CATAAGAGCCACACTTGACC3'. Optimal PCR (polymerase chain reaction) conditions of the pair of the specific primers are established. Different single spore strains of the V26 strain is detected by use of an optimal PCR method, and specific SCAR (sequence characterized amplified regions) markers of the V26 can be obtained by respectively taking of other 13 physiological races and ultra pure water as controls. The molecular detection method is mainly used for early-stage rapid detection of the V26 strain in a large field, the dynamic variation conditions can be known, and the molecular detection method provides reliable technical support and theoretical basis for monitoring of the strain and prevention and control decisions of wheat yellow stripe rust disease.
Owner:王保通 +1

Transcription factor for improving rust disease resistant wheat varieties and screening and obtaining method of transcription factor

The invention belongs to the technical field of crop variety breeding, and discloses a transcription factor for improving rust disease resistant wheat varieties and a screening and obtaining method ofthe transcription factor. The transcription factor is TaWRKY19 and BdWRKY67 of a WRKY transcription factor in brachypodium distachyon, wherein the ORF coding sequence of the TaWRKY19 is SEQID NO:1, and the ORF coding sequence of the BdWRKY67 of the WRKY transcription factor gene in the brachypodium distachyon is SEQID NO: 2. An RNAi mutant of the WRKY transcription factor is obtained through agrobacterium tumefaciens mediated heredity and transformation, brachypodium sylvaticum is inoculated for disease resistance identification, and through the result, the inventor finds that the RNAi plantdisease resistance of the BdWRKY67 is notably improved. The disease resistance of plant wheat obtained through silencing of the TaWRKY19 transcription factor is notably improved, and the resistance ofplants subjected to instantaneous overexpression to puccinia striiformis is also obviously diminished, so that the transcription factor can be used for heredity improvement of stripe rust resistant wheat.
Owner:NORTHWEST A & F UNIV

Wheat stem rust resistance gene

The present invention relates to a transgenic plant which has integrated into its genome an exogenous polynucleotide encoding a polypeptide which confers resistance to Puccinia graminis f. sp. tritici, such as the Ug99 group of races Puccinia graminis f. sp. tritici. In an embodiment, the polynucleotide is the Sr33 gene from Aegilops tauschii.
Owner:COMMONWEALTH SCI & IND RES ORG

Method for forecasting field kendir rust disease and special device therefor

The invention discloses a method for forecasting a kendir rust disease caused by kendir Melampsora and a special device therefor. The method mainly comprises the following steps: manufacturing of a carrier, preparation of a sampling device, sampling and trapping of spores, isolated culture and pathogenicity calculation. The occurrence of the Melampsora of the field-planted kendir can be accurately forecast and predicted, so that a control plan can be effectively made. Compared with the prior art, the invention can effectively determine the quantity of pathogenic bacteria having infectivity while the quantity of pathogenic bacteria can be determined, and especially can solve the problem that isolated kendir leaves which have been sampled in an aeroscope can be easily polluted and rotten in the culture process. Thus, the invention is suitable for forecasting and predicting the Melampsora of the field commercially-planted kendir.
Owner:XINJIANG ALTAY PREFECTURE GAUBAO KENDER CO LTD

Puccinia graminis chitin deacetylase as well as preparation method and application thereof

The invention discloses a puccinia graminis chitin deacetylase as well as a preparation method and application thereof. According to codon preference of pichia pastoris, an optimized nucleic acid sequence is shown as SEQ ID NO.2, and a chitin deacetylase encoding gene sequence of the puccinia graminis is obtained by utilizing a whole-gene synthesis method. Furthermore, a pichia pastoris expressionsystem is used for outperforming secretory expression on the optimized chitin deacetylase encoding gene to obtain chitin deacetylase, and the amino acid sequence of the chitin deacetylase is shown asSEQ ID NO.1. The obtained chitin deacetylase disclosed by the invention can be used for removing acetyl in chitin, chitosan and chitosan oligosaccharide, so that the chitosan or the chitosan oligosaccharide adopting a specific structure is obtained. The chitosan or the chitosan oligosaccharides adopting specific structures can have new or higher biological activity. Therefore, the puccinia graminis chitin deacetylase and a deacetylation product thereof have good industrial application prospects.
Owner:ZHONGKE RUNXIN SUZHOU BIOLOGICAL TECH CO LTD

Colloidal gold test strip used for detecting wheat leaf rust

The invention provides a colloidal gold test strip used for detecting wheat leaf rust. The colloidal gold test strip comprises a sample pad, a colloidal-gold pad, an NC membrane, absorbent paper and a PS base plate, wherein the sample pad, the colloidal-gold pad, the NC membrane and the absorbent paper are successively arranged on the PS base plate along the chromatographic direction of a sample, the colloidal-gold pad is coated by a colloidal gold-labeled monoclonal antibody against Puccinia triticina, the NC membrane successively comprises a detection line and a quality control line along the chromatographic direction of the sample, the detection line is coated with Puccinia triticina antigen protein that the monoclonal antibody can specifically recognize, and the quality control line is coated with a goat anti-mouse secondary antibody. The monoclonal antibody against Puccinia triticina is secreted by a hybridoma cell with an accession number of CGMCC No. 10884. When the test strip is used for detection, the process from sampling to obtainment of detection results only takes 15 min, operation is simple and convenient, the results are accurate, early warning of wheat leaf rust can be realized, and economic loss caused by diseases is reduced.
Owner:INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI

Biological method for inhibiting rapid growth of mikania micrantha

ActiveCN114514836ADecreased net photosynthetic rateReduced net photosynthetic rateInvasive species monitoringPlant cultivationBiotechnologyStoma
The invention belongs to the technical field of biological prevention and control, and discloses a biological method for inhibiting rapid growth of mikania micrantha, which comprises the following steps: measuring the safety of mikania micrantha puccinia peucedanum on non-target organisms; determining the mikania micrantha puccinia infection process; determining the phenotype of mikania micrantha growth inhibition by mikania micrantha puccinia Determining the inhibition of mikania micrantha hormone synthesis by mikania micrantha puccinia And determining the inhibition of mikania micrantha puccinia peucedanum on the photosynthesis of Through measurement of the net photosynthetic rate and the stomatal conductance of mikania micrantha leaves and content analysis of Kalvin cycle pathway related metabolites, it is found that after mikania micrantha puccinia is infected, the photosynthetic rate and the stomatal conductance of the leaves can be remarkably reduced, the content of Kalvin cycle pathway related compounds is inhibited, the net photosynthetic rate is reduced by 10.57%, and the content of Kalvin cycle pathway related metabolites is reduced by 10.57%. The stomatal conductance is reduced by 26.03%, and the content of Kalvin cycle pathway related compounds is reduced by 1.9-3.4 times.
Owner:AGRI GENOMICS INST CHINESE ACADEMY OF AGRI SCI

Penconazole and zhongshengmycin-containing sterilization composition and application thereof

The invention relates to the field of pesticide compounding techniques, particularly relates to a penconazole and zhongshengmycin-containing sterilization composition, and also relates to an application thereof. The penconazole and zhongshengmycin-containing sterilization composition comprises effective ingredients of penconazole and zhongshengmycin with a weight part ratio of (90:1)-(1:90), and the penconazole and zhongshengmycin-containing sterilization composition is prepared into a wettable powder, a suspending agent, an emulsion in water, a water dispersible granule, emulsifiable concentrate and the like after being added with assistants and an excipient, and is used for controlling fungal diseases caused by germs such as erysiphe, uromyces, mortierella, septoria and venturia and bacterial diseases caused by germs such as Gram-positive bacteria, Gram-negative bacteria, mycobacteria and saccharomycetes. The penconazole and zhongshengmycin-containing sterilization composition has a relatively good synergism within a certain range, is superior to a single preparation on the aspect of control effects, is relatively durable in pesticide effect, has a special effect on controlling powdery mildew, rust diseases, scab, leaf spot diseases, gray mold, white rot, soft rot, streak diseases, rice blast, ring spot, gibberellic diseases and bacterial diseases, is relatively low in residue, is relatively easily decomposed after a lasting period, is relatively environment-friendly, and is beneficial to the increase of yield and income in an agricultural district.
Owner:江西绿川生物科技实业有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products