Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular detection method for rapid detection of new puccnia striiformis West f.sp.tritici strain

A technology for wheat stripe rust and bacterial strains, which is applied in the directions of microorganism-based methods, biochemical equipment and methods, and microbial determination/inspection, which can solve the problems of heavy workload, difficulty in identifying a large number of standard samples, and long cycle time

Inactive Publication Date: 2014-05-21
王保通 +1
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional method of identifying hosts has the disadvantages of heavy workload, long cycle, difficulty in identifying a large number of standard samples, and the accuracy is easily affected by external factors such as personnel and identification conditions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular detection method for rapid detection of new puccnia striiformis West f.sp.tritici strain
  • Molecular detection method for rapid detection of new puccnia striiformis West f.sp.tritici strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Sample collection

[0030] On October 5, 2012, the plant disease experimental station of Northwest Agriculture and Forestry University collected wheat leaf samples inoculated with stripe rust bacteria T4, Su11-4, V26, CYR29, CYR31, CYR32, and CYR33, and washed the wheat leaves with deionized water. Store at -80°C for later use.

[0031] 2. Detection of new toxic strain V26 of wheat stripe rust

[0032] (1) Extract the genomic DNA of uredospores of wheat leaf stripe rust;

[0033] (2) PCR amplification: 15 μL reaction system was placed in PCR tubes in turn: 10×Buffer H 1.5 μL, 5U / μL TaqDNA polymerase 0.15 μL, 25 mmol / L MgCl 2 0.9 μL, 0.3 μL of 10 mmol / L dNTPs, 0.75 μL of 10 ng / μL upstream primer and 0.75 μL of downstream primer, 1.5 μL of 50 ng / μL DNA, and finally make up to 15 μL with sterile deionized water. Centrifuge for 10 sec, put the PCR thin-walled tube into the PCR instrument for amplification. The reaction was carried out on a PTC-100 thermal cycler (MJ...

Embodiment 2

[0038] 1. Sample collection

[0039] On November 7, 2012, in Yangling, Shaanxi, 200 asymptomatic wheat leaves were randomly collected; the wheat leaves were rinsed with deionized water and stored at -80°C for later use.

[0040] 2. Detection of new toxic strain V26 of wheat stripe rust

[0041] (1) Extract the genomic DNA of uredospores of wheat leaf stripe rust;

[0042] (2) PCR amplification: 15 μL reaction system was placed in PCR tubes in turn: 10×Buffer H 1.5 μL, 5U / μL TaqDNA polymerase 0.15 μL, 25 mmol / L MgCl 2 0.9 μL, 0.3 μL of 10 mmol / L dNTPs, 0.75 μL of 10 ng / μL upstream primer and 0.75 μL of downstream primer, 1.5 μL of 50 ng / μL DNA, and finally make up to 15 μL with sterile deionized water. Centrifuge for 10 sec, put the PCR thin-walled tube into the PCR instrument for amplification. The reaction was carried out on a PTC-100 thermal cycler (MJ RESEARCH, Inc.), and the amplification program was as follows: the first cycle was 94 °C for 5 min, then 94 °C for 1 min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular detection method for rapid detection of new toxic strain V26 of puccnia striiformis West f.sp.tritici; by a large number of screening, a specific marker of the new toxic strain V26 of the puccnia striiformis West f.sp.tritici is obtained, the specific marker is sequenced, and according to sequencing results, a pair of specific primers comprising V26SP1:5'CTGTAAAGCGGATAAAGGAA 3', and V26SP2:5'CATAAGAGCCACACTTGACC3'. Optimal PCR (polymerase chain reaction) conditions of the pair of the specific primers are established. Different single spore strains of the V26 strain is detected by use of an optimal PCR method, and specific SCAR (sequence characterized amplified regions) markers of the V26 can be obtained by respectively taking of other 13 physiological races and ultra pure water as controls. The molecular detection method is mainly used for early-stage rapid detection of the V26 strain in a large field, the dynamic variation conditions can be known, and the molecular detection method provides reliable technical support and theoretical basis for monitoring of the strain and prevention and control decisions of wheat yellow stripe rust disease.

Description

technical field [0001] The present invention relates to PCR (Polymerase Chain Reaction) technology and RAPD (Random amplified polymorphic DNA) molecular marker technology in molecular biology. Through the specific molecular marker for stripe rust virulence strain V26, the developed SCAR marker is used to quickly detect the A new approach to virulent strains; Background technique [0002] Wheat stripe rust is caused by wheat stripe rust ( Puccnia striiformis West f.sp. .tritici ) caused by a worldwide wheat disease. It has the characteristics of wide occurrence range, fast epidemic speed and large damage loss. my country is the hardest-hit area for wheat stripe rust, and the epidemic year can generally cause 20-30% yield loss. Historically, the disease has caused several major epidemics in my country. The second largest epidemic has reduced wheat production by 6 billion, 3.2 billion, 2.5 billion and 1.4 billion kilograms respectively, causing major losses and threats to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/68C12Q1/04C12R1/645
Inventor 王保通郭婧李强
Owner 王保通
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com