Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

114 results about "Peste-des-Petits-Ruminants" patented technology

A highly fatal contagious disease of goats and sheep caused by PESTE-DES-PETITS-RUMINANTS VIRUS. The disease may be acute or subacute and is characterized by stomatitis, conjunctivitis, diarrhea, and pneumonia.

Kit for detecting antibody against Peste des petits ruminants virus b-ELISA and preparation method thereof

The invention relates to the technical field of biology, particularly the field of viral antibody detection. A kit for detecting the antibody against Peste des petits ruminants virus b-ELISA comprises the following ingredients which are arranged respectively: Peste des petits ruminants nucleoprotein antigen, Peste des petits ruminants monoclonal antibody, diluent, strong positive serum, weak positive serum, negative serum, HRP sheep anti-mouse secondary antibody, 20 times the concentration of washing liquid, substrate liquid, stopping solution and enzyme-linked immunosorbent plate. The optimum proportion of each ingredient in the kit is determined by experiments. The kit can be used for rapid diagnosis and detection of animal Peste des petits ruminants virus antibody, especially for the antibody detection of a lot of samples in the epidemiological survey of Peste des petits ruminants. The detection method of Peste des petits ruminants virus b-ELISA has different detection principle and experiment operating procedures and the like from those of a c-ELISA detection method in a BIRAD laboratory. The Peste des petits ruminants nucleoprotein antigen and Peste des petits ruminants monoclonal antibody in the kit are self-developed. The detection sensitivity, singularity and other indexes of the kit are the same with those of the c-ELISA detection method in the internationally recognized BIRAD laboratory.
Owner:CHECKOUT & QUARANTINE TECH CENT YUNNAN ENTRY &EXIT CHECKOUT & QUARANTINE BUR +1

Peste des petits ruminants virus recombinant protein antigen and rapid test strip for peste des petits ruminants virus antibody

The invention discloses a peste des petits ruminants virus recombinant protein antigen and a rapid test strip for detecting a peste des petits ruminants virus antibody by using the recombinant protein antigen as a detection line reagent. The peste des petits ruminants virus recombinant protein antigen can be obtained by the following steps: selecting main antigenic epitope-containing amino acid segment SEQ IDNo.1 through analyzing the N protein antigenic epitope of the peste des petits ruminants virus, optimizing a codon and artificially synthesizing the codon-optimized gene sequence SEQIDNo.2, constructing a recombinant expression carrier and transforming Escherichia coli for protein expression. The purified peste des petits ruminants virus recombinant protein antigen can be used for detecting the peste des petits ruminants virus antibody. The rapid test strip established based on the peste des petits ruminants virus recombinant protein antigen has the advantages of being convenient to operate, fast to detect, free from special laboratories, equipment and the like, overcomes the limit of the existing detection method, and can be used for rapid detection of the peste des petits ruminants virus antibody and investigation of serum epidemiology.
Owner:SHENZHEN AUDAQUE DATA TECH

Peste des petits ruminants virus H-F fusion protein, biological material related to same and application of peste des petits ruminants virus H-F fusion protein

The invention discloses a peste des petits ruminants virus H-F fusion protein, a biological material related to the same and application of the peste des petits ruminants virus H-F fusion protein. The peste des petits ruminants virus H-F fusion protein is a protein a) or a protein b). The protein a) comprises amino acid sequences shown as SEQ ID No.2; the protein b) is a soluble protein, and each amino acid sequence shown as SEQ ID No.2 is substituted and / or deleted and / or added by an amino acid residue or a plurality of amino acid residues to obtain the soluble protein. The peste des petits ruminants virus H-F fusion protein, the biological material and the application have the advantages that indirect ELISA (enzyme-linked immunosorbent assay) detection methods for peste des petits ruminants virus antibodies are created by the aid of the peste des petits ruminants virus H-F fusion protein which is used as an envelope antigen, are high in specificity and sensitivity and good in accuracy and can be quickly, easily and conveniently implemented, and accordingly the peste des petits ruminants virus H-F fusion protein, the biological material and the application are favorable for clinically monitoring peste des petits ruminants.
Owner:CHINA ANIMAL DISEASE CONTROL CENT

Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique

InactiveCN105018485AObvious amplification curveAmplification curve noMicrobiological testing/measurementDNA/RNA fragmentationForward primerMycoplasma capricolum
The invention aims at providing a primer and a probe for detecting peste des petits ruminants virus by virtue of a RPA (Recombinase Polymerase Amplification) technique. According to the primer and the probe, a forward primer sequence is represented by SEQ ID NO:1, a reverse primer sequence is represented by SEQ ID NO:2, and a probe sequence is represented by SEQ ID NO:3. According to a method, a large number of primers and probes are designed according to genomic sequences of the peste des petits ruminants virus, and a pair of primer and probe combinations capable of rapidly detecting nucleic acid of the peste des petits ruminants virus are screened out; obvious amplification curves can be obtained by carrying out rapid detection by virtue of the primer and the probe and taking nucleic acid RNA of the peste des petits ruminants virus of domestically separated Tibet strains and Xinjiang strains as a template, and no amplification curve is obtained through a reaction by taking other pathogenic nucleic acids such as foot and mouth disease virus, contagious pustular dermatitis virus, mycoplasma capricolum and bluetongue disease virus as the template.
Owner:CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT

Primer and probe for fluorescent RT-PCR (reverse transcription-polymerase chain reaction) assay of peste des petits ruminant vaccine strain viruses

The invention provides a primer sequence and a probe sequence for the real-time fluorescent RT-PCR assay of peste des petits ruminant vaccine strain viruses, the primer sequence includes a primer pair consisting of an upstream primer PPrV-YM1 and a downstream primer PPrV-YM2, the sequences of the upstream primer PPrV-YM1 and the downstream primer PPrV-YM2 are AGGCAGCAAGCCGCAGA and TCCGGTGGTG TCGGATGTGT, or the primer sequence includes a primer pair consisting of the complementary sequence TCCGTCGTTCGGCGTCT of the upstream primer and the complementary sequence AGGCCACCACAGCCTACACA of the downstream primer. The sequence of the probe PPrV-YMp is CCTGTTTACCGCTGGCGTCTCCG, or the complementary sequence of the probe PPrV-YMp is GGACAAATGGCGACCGCAGAGGC. The invention has the advantages of reliable, accurate and sensitive result, time and labor saving, assay cost reduction, assay efficiency increase and the like, is easy to operate, and is particularly suitable for the rapid assay of a large quantity of samples and the rapid diagnosis of emergency epidemics.
Owner:SHENZHEN AUDAQUE DATA TECH

Kit for detecting peste des petits ruminants virus by utilizing pyrophosphoric-acid sequencing technology

The invention provides a kit for detecting peste des petits ruminants virus by a pyrophosphoric-acid sequencing technology. The kit comprises a general primer for detecting peste des petits ruminants and a pyrophosphoric-acid sequencing primer, and the nucleotide sequences are respectively shown in SEQ ID NO.2-4. The kit adopts the following steps of by extracting the RNA of a sample to be detected, carrying out RT-PCR amplification by the general primer; if the length of the amplified fragment of the primer is 78bp, carrying out pyrophosphoric-acid sequencing reaction; if the sequencing fragment is completely the same as N gene target fragments (SEQ ID NO.1), determining to be the peste des petits ruminants virus; if one or more than one basic groups of the sequencing fragment are different from those of the target fragment, determining that the sample is negative. The kit provided by the invention can be used for rapidly detecting the peste des petits ruminants virus, has the characteristics of high flux and low cost, and has the advantages that the products can be directly used for sequencing, secondary treatment is not needed, the operation is extremely convenient, and the needed sample amount is less, so that the application prospect is good.
Owner:CHINESE ACAD OF INSPECTION & QUARANTINE

Method for constructing peste des petits ruminant transgenic plant vaccine efficient expression vector

InactiveCN104498527APrevention of Peste des Petits RuminantsVector-based foreign material introductionGenetic engineeringGMO Plants
The invention relates to recombinant vector construction in the technical field of genetic engineering, in particular to construction used for recombining an efficient expression vector used for preventing and treating peste des petits ruminants. The expression vector comprises F protein genes of F proteins in PPRV and five kinds of recombinant plasmids connected with the genes, wherein the five recombinant plasmids include the pBI121-F, the 121-C-F-M12-M34, the 121-C-FKDEL-M12-M34, the 121-C-G-F-M12-M34 and the 121-C-G-FKDEL-M12-M34; and the gene sequence can be seen in a sequence table.
Owner:QINGDAO AGRI UNIV

Reagent kit used for testing Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) of peste des petits ruminants virus

The invention discloses a reagent kit used for testing Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) of the peste des petits ruminants virus. The reagent kit comprises amplification premixed solution, negative control, positive control and a mixture of SEQIDNO.1 to SEQIDN0.2 amplification primers and an SEQIDNO.3 probe primer. The reagent kit has the advantages that variation of each circular amplicon in PCR (polymerase chain reaction) is tested in real time by the aid of variation of fluorescence signals, a starter template is subjected to quantitative analysis through the relation of Ct values and a standard curve, and the test kit used for testing the peste des petits ruminants virus is high in specificity, good in stability and easy to operate; the test kit has higher sensitivity than common PCR and can be used for testing the peste des petits ruminants virus of low and micro-content samples; the test kit is applicable to not only quantitative analysis of research units but also pathogen testing analysis of prevention and control units at all levels, base veterinary stations and large and medium-sized livestock farms and the like, thereby having good application prospect.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Nanometer immunogold labeling probe for detecting peste des petits ruminants virus (PPRV) and detection kit

The invention provides a nanometer immunogold labeling probe for detecting a peste des petits ruminants virus (PPRV) and a detection kit. Two specific oligonucleotide probes are designed by aiming at a highly conserved region of an N gene of the PPRV. The nucleotide sequence of the 5' modified biotin of one of the probes and the nucleotide sequence of the 3' modified sulfydryl of the other probe are respectively shown by SEQ ID NO.2 and SEQ ID NO.3. The invention also provides a method for detecting the nucleic acid of the PPRV by utilizing the nanometer immunogold labeling oligonucleotide probe. The sulfhydrylated probes are respectively connected onto nanometer gold particles through Au-S bonds; both ends of the targeted nucleic acid are respectively bonded with the two probes to form a hybrid compound, and the targeted nucleic acid is quantitatively detected through bonding the hybrid compound with a solid-phase carrier and performing silver staining on an amplifying signal. According to the detection method provided by the invention, the minimum concentration of the nucleic acid reaches 10fmol/L. The method is high in sensitivity and strong in specificity. A novel method is provided for clinically detecting the PPRV.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI

Methods for prokaryotic expression, eukaryotic expression, purification and monoclonal antibody preparation of V protein of peste des petits ruminants

The invention discloses methods for prokaryotic expression, eukaryotic expression, purification and monoclonal antibody preparation of a V protein of peste des petits ruminants. The methods include: establishing a prokaryotic expression vector pGEX-4T-V for a V gene of a peste des petits ruminant virus; identifying recombined pGEX-4T-V protein by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gelelectrophoresis) and western-blot; purifying the pGEX-4T-V protein and testing concentration; preparing the monoclonal antibody for a recombined pGEX-4T-V protein-immunized mice; preparing ascitic fluid of the monoclonal antibody; preparing the monoclonal antibody through polypeptide synthesis of a segment (a known sequence) of the V gene of the peste des petits ruminants; expressing the V protein of the peste des petits ruminants in eukaryotic expression; subjecting three monoclonal antibodies to indirect immunofluorescence, classification test and the like. The methods provide a reliable technical guarantee and support for diagnosis of the genetic engineering vaccine of the peste des petits ruminants.
Owner:VETERINARY INST XINJINAG ACADEMY OF ANIMAL SCI CLINIC MEDICAL SCI RES CENT XINJIANG ACADEMY OF ANIMAL HUSBANDRY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products