55results about How to "Low false positive rate" patented technology

An integrated surveillance system combining video surveillance and data from other sensor-based security networks is used to identify activities that may require attention.

A security engine may use event-stream processing and behavioral techniques to detect ransomware. The engine may detect process behavior associated with encrypting a file, encrypting a storage device, or disabling a backup file, and may assign a ransomware category to the process based thereon. The engine may initiate protection actions to protect system resources from the process, which may continue to execute. The engine may monitor the process for specific behavior corresponding to its ransomware category. Based on the extent to which such specific behavior is detected, the engine may determine that the process is not ransomware, assign a ransomware subcategory to the process, or adjust the process's threat score. Monitoring of the process may continue, and the threat score may be updated based on the process's behavior. If the threat score exceeds a threshold corresponding to the ransomware category (or subcategory), a corresponding policy action may be initiated.

Methods and computer apparatus are disclosed for deriving first order logic language rules for use in analyzing new data to identify anomalies in the new data. Historical data is formatted to be in a form suitable for application of a machine-learning algorithm thereto. The machine-learning algorithm is applied to the formatted historical data to generate a set of first order logic language rules that cover the formatted historical data. The set of first order logic language rules are analyzed to obtain a subset of said set of first order logic language rules which can be used as first order logic language rules in analyzing new data.

A system and method for monitoring tire pressure in a tire of a vehicle is described, in which a tire pressure reading in the tire and an ambient pressure reading are received, and a warning indicator visible to an operator of a vehicle is selectively activated based on the tire pressure reading, the ambient pressure reading, and a predetermined threshold. In one embodiment, the ambient pressure is used by an engine control system for regulating the air-fuel intake, transmitted to a communications bus, and used by a tire pressure monitoring subsystem configured for receiving the ambient pressure reading from the communications bus.

A hierarchical data structure of digested payload information (e.g., information within a payload, or information spanning two or more payloads) allows a payload excerpt to be attributed to earlier network flow information. These compact data structures permit data storage reduction, while permitting efficient query processing with a low level of false positives. One example of such a compact data structure is a hierarchical Bloom filter. Different layers of the hierarchy may correspond to different block sizes.

This document relates to methods and materials involved in identifying, assessing, and monitoring prostate cancer in male mammals. For example, this document provides arrays for detecting polypeptides or nucleic acids that can be used to identify prostate cancer in male mammals. In addition, methods and materials for assessing and monitoring prostate cancer in mammals are provided herein.

Methods and systems for non-intrusively detecting the existence of fissile materials in a container via the measurement of energetic prompt neutrons are disclosed. The methods and systems use the unique nature of the prompt neutron energy spectrum from neutron-induced fission arising from the emission of neutrons from almost fully accelerated fragments to unambiguously identify fissile material. These signals from neutron-induced fission are unique and allow the detection of any material in the actinide region of the nuclear periodic table.

The invention discloses a multiple PCR detection reagent kit for insect-resistant transgene paddy rice and a detection method thereof. The multiple PCR detection reagent kit mainly comprises the following primer sequences: CaMV-F: GCTCCTACAAATGCCATCA, CaMV-R: GATAGTGGGATTGTGCGTCA, Nos-F: CATGACGTTATTTATGAGATGGG, Nos-R: GACACCGCGCGCGATAATTTATCC, Bt-F: GAAGGTTTGAGCAATCTCTAC, Bt-R: CGATCAGCCTAGTAAGGTCGT. The invention mainly has the advantages that the existing domestic insect-resistant transgene paddy rice can be quickly and accurately detected only through one-time PCR, and the sensitivity can reach 0.1 percent; moreover, the cost is low, the accuracy rate is high, and the false positive rate is low.

The invention relates to an optical device for detecting and identifying damaged paper money by using a photosensitive element. The optical device comprises a luminous tube array, a receiving tube array, a light transmission board and a bracket, wherein the light transmission board is fixedly arranged above the bracket; a luminous signal processing circuit board and a received signal processing circuit board are fixedly arranged at the inner bottom of the bracket; the inner part of the bracket is partitioned into relatively independent light detection cavities by partition walls; each light detection cavity is opposite to the luminous signal processing circuit board and the received signal processing circuit board; and the luminous tube array and the receiving tube array which are matched with each other in the light detection cavity are fixed on the luminous signal processing circuit board and the received signal processing circuit board respectively. By the optical device, the shortcomings of high error distinction rate and leakage rate, high cost, high maintenance requirement and high installation difficulty in the prior art are overcome; due to the specific design, whether various damages exist on paper money or not can be judged accurately; and the optical device has the advantages of low cost, simple structure and low mechanical installation requirement; furthermore, the optical device is not contacted with the paper money, so the optical device is not required to be maintained frequently.

In a method of identifying unusual combinations of values in data (1) that is arranged in rows and columns, the data is pre-processed to put it into a form (4, 5) suitable for application of a search method thereto. Using said search method, the pre-processed data is searched (8) to search the set of possible combinations of unique values from the columns to find any combinations that are unusual according to an evaluation metric.

A method of quickly detecting a handmade explosive in a bottle with a low erroneous alarm frequency is provided. A sample gas generated from a bottle placed on a bottle placement space is sucked-in, and ions of the sample gas are generated by an ion source and subjected to mass analysis. The presence / absence of a mass spectrum derived from the handmade explosive is determined from an obtained mass spectrum, and the result thereof is displayed on a monitor, thereby quickly detecting the handmade explosive in the bottle or the handmade explosive adhering to the surface of the bottle at a low erroneous alarm frequency.

The invention discloses a fingerprint and voiceprint dual-authentication method and a fingerprint and voiceprint collector. The dual-authentication method includes: collecting a fingerprint and triggering voice collection at the same time; performing fingerprint recognition on the collected user fingerprint to obtain a fingerprint recognition score, performing voiceprint recognition on the collected user voice to obtain a voiceprint recognition score; performing integrated computation on the fingerprint recognition score and the voiceprint recognition score to obtain an integrated authentication score; judging a user identity according to the integrated authentication score; if the integrated authentication score is higher than or equal to a preset threshold, considering that both the fingerprint and the voiceprint come from a claimed user himself and the authentication passes, otherwise, considering that the authentication fails in passing. The fingerprint and voiceprint collector comprises a master control circuit which is connected with a fingerprint collector, a microphone and a fingerprint and voiceprint colligative authentication system. Fingerprint recognition and voiceprint recognition are combined to perform dual authentication, and accurately, safety and reliability of local and remote identity authentication are improved greatly by the dual-authentication mode.