The invention discloses a real-time fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent and a detection method for lupulus masking virus. The real-time RT-PCR detection reagent comprises a pair of special primers and a special fluorescent probe. An amplification target fragment is 61bp in length, and the primers have the HLV-F sequence as follows: CGTGGAACGGCTCCTTCTT; the primers have the HLV-R sequence as follows: AGAGTTGTATCCACCGGGTAGTTT; and the probe has the HLV-P sequence as follows: CACCAGCCGGAGTT, 5' of the probe contains FAM report fluorescent dye, and the nucleotide sequence of the amplification target fragment is shown as SEQIDNO:4. The detection method comprises the steps of total RNA extraction and real-time fluorescent PCR reaction, in the RT-PCR reaction, the amplification of the primers and the detection of the probe are conducted simultaneously, a pipe is closed completely in the whole detection process, the PCR aftertreatment is not needed, the pollution caused by a PCR product is eliminated, the detection steps are reduced, the time is saved, and the detection method is special and sensitive for the lupulus masking virus. The detection reagent and the detection method can rapidly and accurately detect the lupulus masking virus, and has flexible operation.