40results about How to "Silent efficiency is high" patented technology

A bactrocera dorsalis Taiman gene is disclosed. The nucleotide sequence of the gene is shown as SEQ ID NO:11 or 12 or 13 or 14. Segmented amplification primer pairs for amplifying the full-length bactrocera dorsalis Taiman gene are also disclosed. Sequences of the primers are shown as SEQ ID NO:1 to SEQ ID NO:10 in order. The invention also discloses dsRNA of the gene, a synthetic method thereof and applications of the dsRNA. The invention discloses a method of subjecting the gene to qRT-PCR detection. Sequences of primers used in qPCR are shown as SEQ ID NO:27 and SEQ ID NO:28. The invention also discloses methods of performing qRT-PCR detection on the Taiman gene shown as the SEQ ID NO:11, 12, 13 and 14 respectively and primer sequences are shown as SEQ ID NO:29 to SEQ ID NO:36 respectively.

The invention provides a bone-targeted delivery system for osteogenesis treatment based on small nucleic acid medicine, and a preparation method thereof. The bone-targeted delivery system comprises liposome, bone-targeted molecules and small nucleic acid medicine, wherein the bone-targeted molecules are one or more selected from bisphosphonate, eight aspartic acid polypeptide repeat sequences, six aspartic acid-serine-serine polypeptide repetitive sequences and screened out aptamer aiming at osteoblastlike cells; and the small nucleic acid medicine is one or more selected from blocking agents of small interfering ribonucleic acid, micro ribonucleic acid mimics and micro ribonucleic acid which have the function of promoting bone formation. Compared with conventional bone-targeted delivery systems, the bone-targeted delivery system has stronger specificity and high transfection efficiency for the small nucleic acid, and can reach relatively high silencing efficiency.

The invention discloses a turnip yellow mosaic virus (TYMV)-induced cruciferous endogenous gene silencing method and application thereof. The method comprises the steps of taking target gene complementary deoxyribonucleic acid (cDNA) as a template for carrying out polymerase chain reaction (PCR) amplification, purifying a connecting vector, converting escherichia coli, and carrying out positive clone sequencing to obtain a target coding region full-length CDS sequence; according to the sequencing result, selecting a (T / A / G / C) TGA, (T / A / C) TAG or (T / A / C) TAA backwards selection 40bp sequence; adding a reverse complementary sequence into the 3' end, adding sequences, which have the homologous sequence length of 15bp and correspond to the two ends of a linearized vector, into the two ends tosynthesize double-stranded DNA fragments, and enabling the synthesized double-stranded DNA fragments to be in fusion connection with a vector pTY-s, converting the escherichia coli by a product of thefusion connection, culturing and extracting plasmids, carrying out gene gun bombardment when first true leaves of seedlings come up, and rapidly transferring the seedlings into cultivation soil for culturing. The TYMV-induced cruciferous endogenous gene silencing method is easy in vector construction, high in transfection efficiency and obvious in gene silencing effect, and maintains characters to be enduring.

The invention discloses a tobacco squalene epoxidase protein with an amino acid sequence shown in SEQIDNO:1. A tobacco squalene epoxidase gene NtSE is a key control gene in the synthetic route of sterol in tobaccos. The gene is specifically highly expressed in young tissues, a built virus mediated gene silenced carrier TRV-NtSE is inoculated to a Ben's tobacco, and then a plant with a high silencing efficiency is obtained; through detecting the content of phytosterol in the Ben's tobacco, a situation that the sterol content of the gene silenced plant is significantly reduced by 21.37% is found, which shows that the silencing of the gene can significantly reduce the sterol content of the plant. The tobacco squalene epoxidase gene NtSE is a key control gene in the synthetic route of sterol in tobaccos, can be used for regulating the sterol content of tobaccos, and facilitates the genetic engineering breeding of low-sterol high-quality tobaccos.

The invention discloses a toxoptera citricida chitin synthase gene. The sequence of the toxoptera citricida chitin synthase gene is shown as SEQ ID NO:3. The invention further discloses dsRNA of the toxoptera citricida chitin synthase gene, and the sequence of the dsRNA is shown as SEQ ID NO:6. The invention further discloses a synthesis method of the dsRNA of the toxoptera citricida chitin synthase gene. The synthesis method includes the following steps that total RNA of toxoptera citricida is extracted and subjected into reverse transcription to form cDNA serving as an amplification template; PCR amplification is carried out through primers with the sequences of SEQ ID NO:4 and SEQ ID NO:5, a product is recycled after electrophoresis, and the dsRNA of the toxoptera citricida chitin synthase gene is synthesized with a gel recycling product as a template. According to the dsRNA of the chitin synthase gene, gene silencing efficiency is high, toxoptera citricida has obvious phenotypic changes after gene interference, and the good application prospects are achieved in the aspect of researching and developing novel pesticide.

The invention discloses a plant DNA virus satellite silencing vector and a construction and use method for the vector. The plant DNA virus satellite silencing vector comes from a satellite molecule incidental with tobacco curly shoot virus-DNA 1, and introduces a single multi-cloning site at the downstream of a Rep open reading frame of the DNA 1. The invention also provides a method for studyingthe functional gene group of plants by taking use of the plant DNA virus satellite silencing vector. The recombinant virus satellite silencing vector containing the target gene of plant is constructed by cloning a cDNA section containing plant target gene by RT-PCR method and inserting the multi-cloning site of DNA 1 virus satellite silencing vector. The recombinant virus satellite silencing vector and DNA-A of China tomato yellowing leaf curling virus are injected and inoculated into a plant by agrobacterium to induce and silence the target gene of the plant so that the surface of the plant will change, and real-time fluorescent quantitative RT-PCR technology is used to detect the expression volume of the target gene so as to determine the function of the gene.

The invention discloses the use of the seabuckthorn endophytic fungus strain SJ1 fermented extract, including inducing the accumulation of endogenous salicylic acid in plants; enhancing the efficiency of plant RNA silencing; and improving the resistance of plants to viruses. The fermented extract of seabuckthorn endophytic fungus strain SJ1 provided by the present invention has a good preventive effect at concentrations of 150ng / mL and 100ng / mL, and the average preventive effects are respectively: 77.45% and 72.88%, both of which are 20% higher than the control guanidine. The preventive effect of copper acetate 5ug / ml (71.98%); comprehensive analysis, the use concentration cost of SJ1 fermented extract 100~150ng / mL is lower than 20% morphine. Copper acetate, the SJ1 fermented extract provided by the present invention is more economical to use.

The invention discloses an application of circular RNAhsa_circ_0007015 in preparation of a medicine for preventing and treating a chronic kidney disease. The target inhibitor of the hsa_circ_0007015 gene can be used for inducing the silencing of the hsa_circ_0007015 gene through RNA (Ribonucleic Acid) interference, so that the occurrence of renal fibrosis is reduced. According to the gene therapy method, expression of fibrosis-related proteins such as [alpha]-SMA, Collagen I and FN in renal tubular epithelial cells can be remarkably reduced, and meanwhile, the renal fibrosis degree after ischemia-reperfusion injury and unilateral ureteral obstruction of adult mice is remarkably improved. Therefore, a targeted inhibitor of the hsa_circ_0007015 gene can play a role in protecting the kidney, and the hsa_circ_0007015 gene serving as a novel gene medicine can be applied to the aspects of treating chronic kidney diseases, relieving the renal fibrosis degree, improving the renal function and the like.

The invention discloses a method for improving the efficiency of chitosan transporting siRNA in vitro, and belongs to the technical field of in vitro siRNA transport. Include the following steps: 1) adopt the method for directly mixing to prepare chitosan / siRNA complex; 2) form the chitosan / siRNA complex in step 1) in Hank's buffered saline solution (HBSS) containing calcium and magnesium transfected cells. At the same time, the method of the present invention also proposes a "one-step method" transfection, that is, directly adding chitosan solution and siRNA in the same proportional amount to HBSS containing calcium and magnesium to transfect cells without premixing. The method is simple in operation and strong in practicability. The method can realize the high-efficiency transfer of siRNA by chitosan in various cell lines, and greatly reduces the cost of the siRNA transfer carrier in vitro.

The invention belongs to the technical field of biomedicine, and in particular relates to a targeted inhibitor of DBF4P1 gene and its application. A targeted inhibitor of the DBF4P1 gene has the effect of inhibiting the expression of the DBF4P1 gene, and the target sequence of the inhibitor is: 5'‑GATATAACGGTGATAGAGCAG‑3' (SEQ ID No.1). Application of the DBF4P1 gene targeting inhibitor in the preparation of drugs for targeted treatment of human brain glioblastoma. The present invention develops a targeted inhibitor of the DBF4P1 gene through RNA interference technology, and the targeted inhibitor can specifically bind the DBF4P1 gene to play a role in inhibiting the expression of the DBF4P1 gene, thereby inhibiting the proliferation and migration of glioblastoma cells and invasion, thereby playing a targeted therapeutic role in inhibiting the growth of glioblastoma. The application of DBF4P1 gene targeting inhibitor can play an important role in the field of glioblastoma gene therapy, and provide new molecular targeted therapy drugs for clinical glioblastoma gene therapy.

The invention relates to a VIGS-based efficient peach leaf gene silencing method, which comprises the following steps: 1, constructing a pCaRNA3-target gene recombinant plasmid, and transferring into agrobacterium tumefaciens GV3101 to obtain positive agrobacterium tumefaciens transferred into the recombinant plasmid; 2, preparing a VIGS transformed bacterium solution by utilizing the positive agrobacterium with the transferred recombinant plasmid, and injecting the VIGS transformed bacterium solution into all completely expanded leaves of a peach seedling with the seedling age of 5-6 completely expanded leaves; and 3, culturing the injected peach seedlings in weak light for 2 days, continuously culturing the peach seedlings in a plant growth room under the conditions of (22 + / -1) DEG C and 16h illumination / 8h darkness, and irrigating a Hoagland nutrient solution during the peach seedling culture period. The practical application of the VIGS gene silencing technology in peaches is optimized, a set of efficient peach leaf gene silencing system is established, the silencing efficiency is high, and the stability is good.

The invention discloses a gene function identification method for a toxoptera citricida, comprising the following steps of 1) synthesizing a corresponding ds RNA solution according to a target gene to be inhibited; 2) introducing the ds RNA solution into the toxoptera citricida by using the method disclosed by the invention; 3) collecting toxoptera citricida bodies to extract RNA after culture, and detecting the condition of expression of the target gene in step 1. The method disclosed by the invention is novel in design, simple in operation, and high in efficiency of gene silencing, the obvious phenotypic change is shown after gene interference, research and application costs are low, the problem that an effective introduction method for the ds RNA does not exist at present is solved, RNA interference on the toxoptera citricida can be steadily and effectively performed, the phenotype is observed through the RNA interference, then the prediction function of the target gene of the toxoptera citricida can be indentified, a new pest control method is explored and studied, and the range of application of the method is wide.

The invention provides a nucleic acid delivery carrier, a preparation method and application of the nucleic acid delivery carrier. The nucleic acid delivery carrier is a nanometer self-assembled bodyof an amphiphilic fluorinated material; and the amphiphilic fluorinated material is perfluorooctane-substituted oligomeric polyethyleneimine. According to the nucleic acid delivery carrier provided bythe invention, oligomeric polyethyleneimine and the perfluorooctane material are bonded together, and due to strong hydrophobicity of the perfluor material, not only can the nucleic acid compressingcapability of oligomeric polyethyleneimine be improved, but also the efficiency of cell endocytosis and endosome escape can be improved; positive charges of oligomeric polyethyleneimine not only can be used for electrostatic composition of siRNA, but also can utilize proton sponge effect to promote the endosome escape in the system, and by the combination of electrostatic composition of siRNA andthe endosome escape, the nucleic acid delivery carrier not only has very-high silence efficiency under the serum-free condition, but also can show very high nucleic acid delivery efficiency in the presence of serum, and is expected to be applied in gene therapy based on siRNA or DNA.

The invention relates to a sucrose fatty acid ester embedded type cationic liposome genetic vector system, a preparing method thereof and applications of the method. The genetic vector system is a composition comprising genetic materials and liposomes formed from cationic lipoids and sucrose esters adopted as auxiliary lipoids. The cationic lipoids comprise peptide type cationic lipoids, gemini cationic lipoids and quaternary ammonium salt type cationic lipoids. The sucrose esters comprise sucrose stearate, sucrose palmitate, sucrose laurate, sucrose oleate and sucrose erucate. The vector can effectively compress plasmid DNA and siRNA and is capable of efficient transfection in vitro and in vivo and nearly free of toxicity for cells and mice. The genetic vector system has a good research and application prospect in gene therapy.

The invention relates to application of an inhibitor of GINS2 genes or protein to the preparation of antitumor drugs. A small-molecular interference RNA sequence aiming at the human GINS2 genes, an RNA interference vector and an RNA interference lentivirus are designed, the silencing efficiency of the GINS2 genes and influence of the GINS2-siRNA lentivirus on the proliferation capacity and apoptosis level of tumor cells are further detected, results show that the proliferation and growth of the tumor cells can be inhibited effectively and the apoptosis of the tumor cells can be promoted after an RNAi method is used to lower the expression of the GINS2 genes, the results indicate that the GINS2 genes are proto-oncogenes and can be used as the targets of tumor treatment, and the RNAi method for silencing the expression of the GINS2 can be used as an effective method to inhibit tumor development. The built siRNA, the RNA interference vector and the RNA interference lentivirus can be used for preparing efficient antitumor drugs.