52 results about "Genus Listeria" patented technology

The present invention relates to methods and compositions designed for the treatment, management, or prevention of cancer, particularly metastatic cancer and cancers of T cell origin, and hyperproliferative diseases involving EphA2-expressing cells. The methods of the invention entail the use of a Listeria-based EphA2 vaccine. The invention also provides pharmaceutical compositions comprising one or more Listeria-based vaccines of the invention either alone or in combination with one or more other agents useful for cancer therapy. In certain aspects of the invention, the methods entail eliciting both CD4+ and CD8+ T-cell responses against EphA2 and / or EphA2-expressing cells.

The present invention includes compositions, methods and kits for inducing an immune response to a tumor and for treating cancer with a Listeria vaccine strain expressing an antigen fused to a truncated LLO protein.

The present invention provides Listeria vaccine strains that express a heterologous antigen and a metabolic enzyme, and methods of generating same.

The invention includes auxotrophic attenuated mutants of Listeria and methods of their use as vaccines.

The invention relates to a method for detection Listeria monocytogenes with loop-mediated isothermal amplification-CdS nanoparticles labeling electrochemistry. The method is characterized in that the method comprises the following steps of: obtaining double-stranded target sequence of amplification reagent-Listeria monocytogenes to be detected by means of loop-mediated isothermal amplification reaction; pyrolyzing a double-stranded target sequence in water bath into a single-stranded target sequence, then self assembling and fixing at the surface of gold electrode, so that the target sequence modified electrode of the Listeria monocytogenes to be detected is obtained; afterwards, labeling the probe sequence coming from the Listeria monocytogenes by CdS nanoparticles to obtain a labeled probe sequence; carrying out molecular hybridization on the labeled probe sequence and the target sequence of the target sequence modified electrode, and carrying out electrochemical detection by simultaneity plating Hg anodic stripping method; detecting out cadmium ions corresponding to the species-specific genes (actA) of the detected Listeria monocytogenes. The method has the advantages of speediness, strong specificity, high sensitivity and convenient use.

Isolation plating medium of a first color for the identification of Listeria sp. and Listeria monocytogenes and Listeria ivanovii containing a first chromogenic substrate that responds to phosphatidylinositol-specific phospholipase C enzymes to release precipitate of a second color into the medium and a second chromogenic substrate that responds to beta-glucosidase enzymes to release precipitate of a third color into the medium, and said first, second and third colors contrasting with each other.

The present invention belongs to the field of microbe detecting technology. The oligonucleotide probe for detecting common intestinal tract pathogenic bacteria is designed on 16S rRNA and 23S rRNA of bacteria, ipaH of dysentery bacillus giant plasmid, VipR of Salmonella typhi and other gene sequence, has length of 25-50 bp, and relatively high sensitivity and specificity. The oligonucleotide probe is suitable for detection based on nucleic acid hybridization principle, especially detection based on gene chip principle. Under certain use condition, it can detect Listeria, parahemolutic vibrio, Campylobacter, etc. It may be used in many aspects, such as disease diagnosis, environment detection, food poisoning detection, etc.

An oligonucleotide specifically binding to 23S rRNA gene of Listeria spp., and a kit and a method of efficiently detecting Listeria spp. in a sample by using the oligonucleotide are provided.

The present invention relates to virulent (lytic) Listeria monocytogenes phage from the Myoviridae family, preferably P100, alone or in combination with other virulent phages. P100 and the endolysin from P100 can be administered to food products, to the components that will be added to food products, and / or to the infrastructure of the food processing plants within which such food products are processed, or the containers or wraps in which such foods are stored and / or shipped, in order to reduce Listeria monocytogenes contamination. P100 can also be used in the present invention to identify Listeria monocytogenes bacteria present on (or within) foodstuffs, as well as those Listeria monocytogenes bacteria present in the equipment or the general environment of the food processing plants in which the foodstuffs are being processed and in animals infected with Listeria monocytogenes. The phage and the endolysin of the present invention can also be used to treat animals infected with Listeria monocytogenes. P100 will kill the bacteria that are within its host range with great efficiency and will propagate to high titer thereon. P100 can be combined with other lytic phage, and / or with other antimicrobial agents to reduce or eliminate Listeria.

An antimicrobial, anti-bacterial processing aid, food additive and food ingredient is provided to inhibit cellular growth of known pathogenic, indicator and spoilage organisms, such as salmonella, stahphylococcus, listeria, e coli, and the like. The antimicrobial agent of the present invention is useful as a treatment for animal feed, a treatment for pre-harvest and post-harvest processing of foodstuffs, a treatment for cooked food subject to airborne contaminants and many other conditions in need of disinfectants and sanitizers. One of the primary benefits of the antimicrobial agent is that it inhibits the growth of bacteria that have become antibiotic resistant.

A method of detecting a phosphatidylinositol-specific phospholipase C enzyme by means of a substrate which is cleaved by said enzyme and yields a dye when the chromophoric portion of the substrate is dimerized and oxidized; the invention teaches using in such method, as a novel substrate, a 3-indoxyl-myo-inositol-1-phosphate compound of formula (I) wherein R is selected from the group consisting of hydrogen and C1-4 alkyl, while R1, R2, R3, and R4 are radicals selected from the group consisting of hydrogen, halogen, cyano, nitro, carboxy, amino, alkyl-substituted amino and sulphonyl; or of a salt of said formula I compound. The invention provides for a safe and sensitive method of detection of potentially pathogenic bacterial activity of such microbes as Bacillus cereus, B. Thuringiensis, Staphy lococcus aureus and various Listeria strains in potentially infected materials including physiological samples or consumable goods such as foods and beverages.

The invention discloses a method for detecting viable Listeria monocytogene, relating to a method for detecting Listeria. The invention solves the problem that the prior method for detecting viable Listeria monocytogenes is easy to produce false positive. The method for detecting viable Listeria monocytogenes is carried out as following steps: after extracting bacterial sludge from articles to be detected, extracting RNA to implement retrotransposon and real time PCR; accordingly, a collection of illustrative plates which are capable of determining whether the articles contain viable Listeria monocytogenes or not. The method has the advantages of high sensitivity, good specificity, simple operation, and comparatively short period. The method meets the requirements of pathogen rapid detection in food industry.

This invention provides methods and compositions for using a live attenuated Listeria for inhibiting cell-mediated suppression of anti-disease infiltrating T lymphocytes in a subject having the disease.

The invention discloses a double-antibody sandwich ELISA (enzyme-linked immuno sorbent assay) method for detecting listeria in food on the basis of monoclonal antibodies, belonging to the technical field of immunoassay. The method comprises the following steps: immunizing 8-week BALB mouse with prokaryotically expressed listeria monocytogenes P60 protein, and obtaining 15 strains of listeria specific monoclonal antibodies by immunization, fusion and multiple screening; respectively marking horse radish peroxidase HRP, and carrying out pairwise coupling by taking the listeria monocytogenes CMCC54003 as targets. The sandwich ELISA method which is established by screening different paired cross reactions and taking 2G7 as a coating antibody and 2H8-HRP as an enzyme labelled antibody has cross reactions to listeria including the listeria monocytogenes, and has no cross reactions to tested staphylococcus aureus, escherichia coli, escherichia coli O157, salmonella, enterobacter sakazakii, campylobacter jejuni and campylobacter coli. According to the method disclosed by the invention, the monoclonal antibodies having listeria specificity are prepared and the double-antibody sandwich ELISA method is established, and the method provides a technical means for specific rapid detection of the listeria in food.

The invention relates to a device and method for detecting Listeria monocytogenes in a sample. The method mainly solves the technical problem that the prior Liseria monocytogene detection kit can detect a single sample and has complicated detection procedures and low sensitivity. The kit contains the following reagents: a reagent A, which is a sample pretreatment solution; a reagent B, which contains magnetic beads; a reagent C, which is a DNA extracting solution; a reagent D, which is a PCR reaction solution containing two pairs of specific primers which are A08650 and A08653, and A08653 andA08654. the sequences of the two pairs of specific primers are 5'GGGGAACCCACTATCTTTAGTC and 5'GGGCCTTTCCAGACCGCTTCA, and 5' GCCTGCAAGTCCTAAGACGCCAATC and 5' CTTGCAACTGCTCTTTAGTAACAGC, respectively. The method is maily used for rapid detection of Listeria monocytogeners in the sample.

Site-specific Listeria integration vectors and methods for their use are provided. The subject vectors include a bacteriophage integrase gene and a bacteriophage attachment site, where in many embodiments the bacteriophage that is the source of these elements is a listeriophage. In certain embodiments, the subject vectors further include a multiple cloning site, where the multiple cloning site may further include a polypeptide coding sequence, e.g., for a heterologous antigen. The subject vectors and methods find use in a variety of different applications, including the study of Listeria species and the preparation of Listeria vaccines.

Provided herein are recombinant Listeria strains expressing a tumor-specific antigenic polypeptide and, optionally, an angiogenic polypeptide wherein a nucleic acid molecule encoding at least one of the polypeptides is operably integrated into the Listeria genome in an open reading frame with a nucleic acid sequence encoding a PEST-containing polypeptide, methods of preparing same, and methods of inducing an immune response, and treating, inhibiting, or suppressing cancer or tumors comprising administering same.

The invention is a selective growth medium for investigating, isolating, counting and directly identifying pathogenic bacteria of the genus Listeria.The medium promotes the Listeria spp. while simultaneously inhibiting the growth of non-Listeria organisms. The medium does not produce a bacterial biomass contaminated with interfering fluorophores. The medium contains nitrofurantoin, esculin and lithium chloride and lacks acriflavin.

A strain of Lactobacillus salivarius isolated from resected and washed human gastrointestinal tract inhibits a broad range of Gram positive and Gram negative microorganisms and secretes a product having antimicrobial activity into a cell-free supernatant. The activity is produced only by growing cells and is destroyed by proteinase K and pronase E, the inhibitory properties of the strain and its secretory products being maintained in the presence of physiological concentrations of human bile and human gastric juice. The strain exhibits a broad-spectrum of activity against bacteria including Listeria, Staphylococcus, including methocillin resistant St. aureus (MRSA), and Bacillus, but does not inhibit many closely related lactobacilli. An antimicrobial agent is obtained from the strain which has bacteriocin-like properties.

The invention relates to a detection method of Listeria monocytogenes PCR with monocyte hyperplasia used for adding internal amplification control for food safety, pertaining to the biological technical field. The invention comprises the steps: a section of internal amplification control sequence is synthesized artificially, and corresponding special primers are designed; the concentration of MgCl2 and the anneal temperature are optimally selected; PCR testing and comparison are made to choose an adding concentration which has least effect to detection sensitivity and is capable of clearly indicating the concentration of the internal amplification control of false negative; whether the specific and the internal amplification control of primers can be normally enlarged in the testing of a Listeria monocytogenes sample with the monocyte hyperplasia can be determined; the stability of a PCR testing system is estimated through interference-free experiments; whether the false negative of the internal amplification control is indicated or not is judged by testing the artificial pollution sample; the accuracy of the testing result of the PCR testing system is estimated. The invention improves the accurate rate of the PCR testing and provides effective and reliable technical means to investigate and test food-borne pathogenic bacteria required during quarantine and law enforcement process.

The invention relates to a colloidal gold test paper strip for detecting Listeria or Listeria monocytogenes in food based on monoclonal antibody, and applications thereof, and belongs to the technical field of immunological analysis. According to the colloidal gold test paper strip, a sample pad, a nitrocellulose membrane and a water absorbing pad are sequentially arranged on a PVC bottom plate; the gold-labeled antibody is the colloidal gold solution of antibody 2H8 when the Listeria in the food is detected based on the monoclonal antibody; and the gold-labeled antibody is the colloidal gold solution of antibody A when the Listeria monocytogenes in the food is detected based on monoclonal antibody. According to the present invention, the colloidal gold test paper strip for detecting the Listeria or the Listeria monocytogenes in the food based on the monoclonal antibody is developed, and is suitable for the high-specificity, high-accuracy, high-sensitivity, rapid and convenient analysis of the Listeria or the Listeria monocytogenes in the food.

The present invention provides methods of treating, protecting against, and inducing an immune response against a human papillomavirus-associated tumor or cancer, comprising the step of administeringto a subject a recombinant Listeria strain expressing a construct comprising at least one human papillomavirus antigen.

The disclosure is directed to compositions comprising an oncolytic virus, chimeric antigen receptor T cells (CAR T cells), a therapeutic or immunomodulating monoclonal antibody, a targeting thymidine kinase inhibitor (TKI), or an adoptively transferred cells incorporating engineered T cell receptors, and a live attenuated recombinant Listeria strain comprising a fusion protein of a Truncated LLO, a truncated ActA or a PEST-sequence peptide fused to a tumor-associated antigen. The disclosure is further directed to methods of treating, protecting against, and inducing an immune response against a tumor, comprising the step of administering the same, with or without an additional radiation therapy treatment.

Disclosed herein are compositions comprising use of compositions comprising a live attenuated recombinant Listeria strain comprising a fusion protein of a truncated listeriolysin O (LLO) protein, a truncated ActA protein, or a PEST amino acid sequence fused to a heterologous antigen, including a tumor-associated antigen, wherein the compositions further comprise or are co-administered with an antibody or fragment thereof. Also disclosed are combination therapies comprising use of these compositions comprising live attenuated recombiant Listeria strains, in conjuction with an antibody or fragment thereof for use in treating, protecting against, and / or inducing an immune response against a tumor, especially wherein the treating, protection against and / or inducing an immune response increases percent survival in a subject.

The present invention relates to virulent (lytic) Listeria monocytogenes phage from the Myoviridae family, preferably P100, alone or in combination with other virulent phages. P100 and the endolysin from P100 can be administered to food products, to the components that will be added to food products, and / or to the infrastructure of the food processing plants within which such food products are processed, or the containers or wraps in which such foods are stored and / or shipped, in order to reduce Listeria monocytogenes contamination. P100 can also be used in the present invention to identify Listeria monocytogenes bacteria present on (or within) foodstuffs, as well as those Listeria monocytogenes bacteria present in the equipment or the general environment of the food processing plants in which the foodstuffs are being processed and in animals infected with Listeria monocytogenes. The phage and the endolysin of the present invention can also be used to treat animals infected with Listeria monocytogenes. P100 will kill the bacteria that are within its host range with great efficiency and will propagate to high titer thereon. P100 can be combined with other lytic phage, and / or with other antimicrobial agents to reduce or eliminate Listeria.