138 results about "Oleanane" patented technology

The invention relates to a centella asiatica triterpenic acid single-glucopyranoside composition which is composed of ursane madecassic acid single-glucopyranoside, madecassic acid single-glucopyranoside and oleanane chebuloside II, wherein the mass ratio of ursane madecassic acid single-glucopyranoside to madecassic acid single-glucopyranoside to oleanane chebuloside II is 1:0.5-2:0.1-1, and the sum of the mass percentage content of three components is not less than 50%. The composition takes a centella asiatica extract as a substrate, the centella asiatica extract is fermented and hydrolyzed by microbes of beta-glucosidase or microbes capable of generating beta-glucosidase, and extracted by n-butanol or separated and purified by macroporous adsorption resin. The invention also provides a quantitative analysis method which is a HPLC quantitative analysis for three components by adding a proper amount of mobile phase of beta-cyclodextrin. Experimental research of pharmacodynamics proves that the composition has substantial activity for inhibiting tumor cells and fibroblast, the composition can be used for treating tumor and scar hyperplasia.

The present invention relates to the use of oleanane-type triterpene saponin compounds, which are effective for improving memory and learning ability, as an effective ingredient of drugs for the treatment and prevention of dementia and mild cognitive impairment and health foods for the improvement of brain functions including cognitive function.

The invention belongs to the field of pharmacy of traditional Chinese medicines, relating to an extract of effective parts of total saponins in pterocephalus hookeri as well as a preparation method and application thereof. By taking the content of the total saponins in the pterocephalus hookeri as an index, the extract of the total saponins in the pterocephalus hookeri provided by the invention has the characteristics of high content of the total saponins, controllable and stable quality and obvious drug effect. The main component of the extract is oleanane type pentacyclic triterpene saponins, and the content of the total saponins is 50%-90%. The preparation method provided by the invention is economical and simple in extraction technique and is applicable to industrial production. The obtained extract has obvious function of restraining the tumor cell proliferation, and can be applied in preparation of anti-tumor drugs.

The invention discloses a novel organic salt-a berberine glycyrrhizic acid enantiomer salt which can be used for medicine, and a preparation method and usage thereof. The chemical name of the berberine glycyrrhizic acid enantiomer salt is 5,6-dihydro-9,10-dimethoxy-benzo (g)-1,3-benzo-dioxolane[5,6-a]quinolizidine.18a(beta),20beta-carboxy-11-oxo-30-norolean-12-alkene-3beta-yl-2-O-beta-D-glucopyranuronosyl-a-D-glucopyranosiduronic acid. The preparation method comprises the steps that berberine hydrochloride is dissolved with water according to the pharmaceutical co-crystal principle, anion exchange resin is added, then the mixture is stirred for one hour and filtered, the filtrate is put into a water solution of a glycyrrhizic acid enantiomer and stirred for 30 minutes for centrifugation, the precipitate is dissolved in ethanol, and decompression is carried out to remove the solvent to get the berberine glycyrrhizic acid enantiomer salt. The organic salt with double mother nucleuses has practical significance for human in resisting diabetes, hyperlipidemia, tumor and chronic inflammatory diseases of rheumatoid arthritis, hepatitis, Alzheimer and the like and developing the medical industry.

The invention discloses a wedelia trilobata anti-tumor extract and preparation and application methods thereof. The wedelia trilobata anti-tumor extract is prepared by adding solvent into wedelia trilobata powder for extraction, filtering and decompression-concentrating extracted liquor to obtain a total extract, mixing the total extract with water into a suspension, performing extraction sequentially through petroleum ether and ethyl acetate and performing decompressed recovery to obtain a petroleum ether solution, an ethyl acetate solution and a aqueous solution, wherein the petroleum ether solution contains one eudesmene type sesquiterpene lactone, five enantiotopic kaurane type diterpenoid compounds, two oleanane type triterpenes, one cycloartane type triterpene, one sterol compound, two dipeptide compounds and one caffeate compound. The prepared wedelia trilobata anti-tumor extract is high in yield, simple in technical process, low in cost and applicable to large-scale preparation, and meanwhile, has broad-spectrum anti-tumor activity and can serve as an active component applied to tumor control and treatment drugs.

The invention relates to an 18Alpha-glycyrrhetinic acid o-phthalate, a method for preparing the 18Alpha-glycyrrhetinic acid o-phthalate and the application thereof in drugs. The invention aims at providing an 18Alpha-glycyrrhetinic acid o-phthalate which has safe use, strong pharmacological activity, and fast effect, and a method for preparing the 18Alpha-glycyrrhetinic acid o-phthalate; and the method has the advantages of simple process, and high product quality and yield. The technical proposal provided by the invention is as follows: the 18Alpha-glycyrrhetinic acid o-phthalate is characterized by being a pentacyclic triterpenoid derivative of o-phthalic acid which has the chemical name of 3-(1-carboxy-2-oxidation phenoxy)-11-O-18Alpha-oleanane-12-ene-29-formate, the molecular weight of 618.8, and the molecular formula of C38H 50O7 question mark R.

The invention discloses a panax japonicas beta-amyrin synthase gene and an application thereof. The panax japonicas beta-amyrin synthase gene is obtained by using a positive primer P1:5'ATGTGGAAGCTTAAGATAGCGGA3' and a reverse primer P2:5'TTAGGTGCCAAGGGACGGTGAT3', and taking a panax japonicas cDNA library as a template to amplify; the sequence of the panax japonicas beta-amyrin synthase gene is as shown in SEQIDNO.1. The panax japonicas beta-amyrin synthase gene is introduced into the panax japonicas by agrobacterium-mediated genetic transformation, so that the content of oleanane type saponin in the panax japonicas is increased.

The invention discloses a 3-monouronic acid o-glycoside oleanane type and ursane type triterpenoid saponin derivative. The derivative has a structural formula as shown in the specification, wherein R4 is one of H atom, alkyl containing 1-10 carbons, alkyl amido containing 1-10 carbons, aryl containing 6-11 carbons and saturated or unsaturated ring containing 3-7 carbon atoms. According to the preparation method, oleanolic acid or ursolic acid is used as a lead compound, and is structured to synthesize a novel 3-monouronic acid o-glycoside oleanane type and ursane type triterpenoid saponin derivative. The synthesizing method is simple and convneient, the product has high purity, and the anti-arrhythmia activity of the 3-monouronic acid o-glycoside oleanane type and ursane type triterpenoid saponin derivative is remarkably enhanced by means of structure transformation. The 3-monouronic acid o-glycoside oleanane type and ursane type triterpenoid saponin derivative has a relatively good cardiac muscle protecting effect.

The invention provides oleanane-type triterpenoid saponin compounds as shown in the structural formula (I). In the structural formula (I), R1 represents alpha-L-rhamnose-(1->2)-alpha-D-galactose-(1->2)-beta-D-glucuronic acid, or beta-D-glucose-(1->3)-[alpha-L-rhamnose-(1->2)]-alpha-D-galactose-(1->2)-beta-D-glucuronic acid; R2 is replaced by glucose or hydrogen. The invention further provides combinations of the oleanane-type triterpenoid saponin compounds, plant extracts containing the oleanane-type triterpenoid saponin compounds, preparation methods of the oleanane-type triterpenoid saponin compounds, the oleanane-type triterpenoid saponin compounds and the plant extracts, and application of the oleanane-type triterpenoid saponin compounds, the plant extracts and the compositions to the field of sweeteners. Researches on folk characteristic medicinal plants in Yunnan show that the sweetness of Dai medicine derris eriocarpa How. is obvious; via gustation activity-guided isolation, the oleanane-type triterpenoid saponin compounds of high sweetness are separated from derris eriocarpa How.

The invention relates to an oleanolic acid glucuronyl transferase as well as an encoding gene and application thereof, and belongs to the field of plant genetic engineering and biotechnology. The amino acid sequence of the oleanolic acid glucuronyl transferase disclosed by the invention is as shown in SEQ ID NO. 4. And the nucleotide sequence is as shown in SEQ ID NO.8. According to the oleanolic acid glucuronyl transferase disclosed by the invention, uridine diphosphate glucuronic acid can be specifically used as a glycosyl donor to catalyze a glycosylation reaction at a C-3 site of oleanolic acid, so that the oleanolic acid 3-O-beta-glucuronic acid is generated. The transferase is an enzyme in the upstream step in the oleanane type saponin synthesis process, and has important significance for analyzing the synthesis route of the oleanane type saponin.