Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

50results about How to "Accurate and efficient identification" patented technology

Intelligent restaurant ordering management system and intelligent restaurant ordering management method based on human face recognition technology

The invention discloses an intelligent restaurant ordering management system based on a human face recognition technology. The intelligent restaurant ordering management system comprises intelligent devices such as a database module, a data processing module, a wireless communication module, an intelligent ordering table in which a touch screen is embedded, a tableware device in which various sensors are embedded, and a cellphone; the intelligent restaurant ordering management system is characterized in that the human face recognition technology, automatic closed-loop feedback control theory and data digging are combined with the intelligent restaurant ordering management system, and the surrounding temperature and humidity of a member are regulated by use of the automatic closed-loop feedback control theory; the identity of the member is identified by use of the human face recognition technology and the basic information of the member is stored; the data digging technology is used for analyzing the data in database and helping the member order food; as a result, a food material buyer can supplement food materials reasonably, and highly targeted service information can be pushed.
Owner:HOHAI UNIV CHANGZHOU

Insurance policy analysis method and device, terminal equipment and storage medium

The invention discloses an insurance policy analysis method and device, terminal equipment and a storage medium. The method comprises steps that the insurance policy information of each insurance policy is acquired from an insurance policy database; to-be-matched parameters are determined according to the attribute information; for each to-be-matched parameter, traversal of each insurance policy is carried out, and the direct relationship based on the to-be-matched parameters is established between different insurance policies having the same parameter values; the insurance policy identifier information is taken as network nodes, parameter values of the to-be-matched parameters are taken as relationship nodes, the network nodes having the direct relationship are associated with the relationship nodes establishing the direct relationship to construct the insurance policy relationship network; according to the insurance policy relationship network, the gang fraud risk is analyzed. The method is advantaged in that relevance among the different insurance policies is represented through the constructed insurance policy relationship network, identification and early warning of the gang fraud risk can be accurately and efficiently carried out through analyzing the relevance, and the gang fraud risk identification rate is improved.
Owner:CHINA PING AN LIFE INSURANCE CO LTD

Training and recognition method and device for visible light fault model of photovoltaic module

The invention discloses a training and recognition method and device for a visible light fault model of a photovoltaic module. The method comprises the steps of in response to an obtained to-be-detected image, cutting the to-be-detected image; marking pixel coordinates of each piece of image data in the to-be-detected image; in response to the acquired multiple pieces of image data, outputting target object image data in the multiple pieces of image data by a Faster-RCNN training model; judging whether the pixel coordinates of the image data of a certain obstacle are within the range of the pixel coordinates of all photovoltaic module image data or not; and if the pixel coordinates of the image data of a certain obstacle are within the range of the pixel coordinates of all photovoltaic module image data , outputting the pixel coordinates of the image data of the obstacle. By extracting the image features of the photovoltaic module and the bird droppings, the coordinate range of the photovoltaic module and the coordinates of the bird droppings in the detected image are identified, and the overlapped part of the coordinate range and the coordinates of the bird droppings is marked asthe bird droppings covering fault point of the photovoltaic module, so that the identification of the bird droppings shielding fault point of the photovoltaic module is realized.
Owner:STATE GRID JIANGXI ELECTRIC POWER CO LTD RES INST +1

Primers for identifying soybean male sterile line and method thereof

The invention relates to the technical field of gene engineering, and provides primers for identifying a soybean male sterile line and a method thereof. The primers are disclosed as SEQ ID NO.1 and SEQ ID NO.2. The method comprises the following steps: carrying out PCR (polymerase chain reaction) amplification and BstXI enzyme digestion on the template soybean genome DNA by using the primers; and judging the soybean is the male sterile line if the product only contains one 472bp strip, and judging the soybean is the male fertile line if the product comprises 266bp and 202bp. On the basis of detecting that the soybean male-sterile character is controlled by a pair of recessive single genes, the invention develops a codominant molecular marker for identifying the soybean male sterile line, and provides the primers for identifying the soybean male sterile line and the method thereof. The primers and method can perform efficient accurate identification on the soybean fertility and genotype in any period in the soybean breeding process, thereby providing a new way for molecular identification of the soybean male sterile line.
Owner:ANHUI AGRICULTURAL UNIVERSITY

Parallel arm intelligent silkworm cocoon sorting robot and silkworm cocoon sorting method

The invention relates to a parallel arm intelligent silkworm cocoon sorting robot and a silkworm cocoon sorting method. The parallel arm intelligent silkworm cocoon sorting robot comprises a main control system, an image collecting device, a silkworm cocoon conveying system and a parallel arm sorting manipulator, and the collecting end of the image collecting device faces silkworm cocoons conveyed by the silkworm cocoon conveying system; and the execution tail end of the parallel arm sorting manipulator is located above the silkworm cocoon conveying system, and the image collecting device and the parallel arm sorting manipulator are both electrically connected with the control system. According to the parallel arm intelligent silkworm cocoon sorting robot, the parallel arm sorting manipulator is adopted, a negative pressure type suction cup is adopted, accurate silkworm cocoon grabbing is achieved, and secondary damage to silkworm cocoons is avoided; silkworm cocoon images are acquired through an upper camera and a lower camera, so that the recognition accuracy is improved; through a constructed silkworm cocoon classification CNN model based on deep learning, accurate and efficient identification and classification of the silkworm cocoons are realized; and the control system converts the position coordinates of the silkworm cocoons and drives the parallel arm manipulator to act to grab the silkworm cocoons, so that efficient and automatic sorting of the silkworm cocoons is realized.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Molecular marking method for predicting and identifying chicken abdominal fat amount and applications thereof

The invention discloses a molecular marking method for predicting and identifying chicken abdominal fat amount and applications, and belongs to the technical field of animal molecular genetics. The molecular marking method for predicting and identifying chicken abdominal fat amount can identify low-fat broilers more accurately and conveniently, and accelerate broiler breeding process. According tothe method, primers are designed according to chicken HBP1 gene SNP site g. -4354T>A upstream 337bp and downstream 27bp sequence; and PCR amplification on chicken genome DNA is carried out accordingto the obtained primers, then forced enzyme digestion on the amplification product by using restriction enzymes is carried out, and polyacrylamide gel electrophoresis separation on enzyme digestion products is carried out to obtain the chicken abdominal fat labeled genotypes. The method is simple to operate, low in cost and high in accuracy, can be used for automatic detection, is an effective molecular marker breeding means, can provide a scientific basis for marker-assisted selection of chickens, and can be used for accelerating the breeding process of the chickens and breeding low-fat broilers meeting market requirements, so that relatively good economic benefits are obtained.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Method for rapid artificial inoculation in-vitro identification of Batryris elliptica Cocke resistance

A method for the rapid artificial inoculation in-vitro identification of Batryris elliptica Cocke resistance comprises the following steps: culturing Batryris elliptica Cocke in a culturing container by using a potato and oat starch culturing medium, disinfecting by using an autoclave, and standing for cooling to prepare a culturing medium; acquisition of lily to be measured: taking healthy initial-squaring-stage young lily plants which are not infected with Batryris elliptica Cocke pathogens and must have 6-9 healthy blades, and respectively taking complete lily blades from an upper position, a middle position and a lower position; pathogen acquisition: taking typical infected lily blades, separating and purifying pathogens, identifying the pathogens as Batryris elliptica Cocke, culuring the pathogens on the potato and oat starch culturing medium for 7d, and inoculating the healthy lily blades; inoculating by adopting a mycelium block inoculation process, a spore spray inoculation process or a mechanical inoculation process; wrapping petiole wounds of the pathogen inoculated lily blades with wet cotton, putting the inoculated lily blades in a culture dish, and sprinkling a proper amount of sterile water to carry out moisture retention culture; and investigating the disease infection conditions of the blades at the 3th day, the 5th day, the 7th and the 9th day, observing, and identifying. The Batryris elliptica Cocke resistance of different varieties of lily can be accurately and efficiently identified under controllable conditions through the method.
Owner:SHENYANG AGRI UNIV

Primer, kit and method for identifying cobitidae fishes

The invention discloses a primer, a kit and a method for identifying cobidae fishes. The identification primer comprises a first primer pair and a second primer pair, the upstream and the downstream of the first primer pair respectively have nucleotide sequences shown as SEQ ID NO.1 and SEQ ID NO.2, and the upstream and the downstream of the second primer pair respectively have nucleotide sequences shown as SEQ ID NO.3 and SEQ ID NO.4. The method for identifying the cobidae fishes comprises the following steps of, S1, acquiring DNA of a cobidae fish sample; s2, carrying out PCR amplification on the DNA obtained in the S1 by using the first primer pair to obtain a first PCR amplification product; s3, performing nested PCR amplification by using the second primer pair, and obtaining a second PCR amplification product by using the first PCR amplification product as a template; s4, performing agarose gel electrophoresis and gel cutting purification on the second PCR amplification product obtained in S3 to obtain a purified second PCR amplification product; and S5, sequencing the purified second PCR amplification product, comparing mitochondrial gene sequences of the known species of the cobidae fishes in an NCBI database according to a base sequence of a sequencing result, and determining the species of the cobidae fish sample.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Automatic identification method for plate edges

An automatic identification method for plate edges is characterized by comprising the following steps: firstly, plate characteristic edges are defined; secondly, defining a feature code for the feature edge of the plate; thirdly, characteristic codes are additionally sprayed or attached to the edge of the two-dimensional code while the identity identification code is sprayed or attached to the plate; fourthly, acquiring two-dimensional code information and feature code information of the plates entering the production line by using a camera; fifthly, decoding the two-dimensional code information and the feature code at the same time; obtaining information of a board pair to be machined, determining whether the information of the board pair to be machined is matched with pre-stored information of a system, obtaining whether the information of a machining edge needing to enter machining is consistent with the pre-stored information through feature code decoding, if yes, continuing to enter a next procedure of the board, and if not, automatically performing board replacement or edge adjustment by the system. The method can improve the identification speed and accuracy of the plate edges on the plate production line, improves the production efficiency, and reduces the production cost.
Owner:NANJING DIDING NUMERICAL CONTROL TECH

Method for identifying Vietnam camellia oleifera, Camellia odorata, Camellia frutescens and common Camellia oleifera

The invention relates to a method for identifying Camellia Vietnamese (Camellia Vietnamese), Camellia nobilis (C. osmantha), Camellia frutescens (i.e., Camellia oleifera, C. oleifer var.monosperma) and Camellia oleifera (i.e., Camellia oleifera, C. oleifer). The invention relates to a method for identifying Camellia vietnamese, Camellia nobilis, C. oleifer. According to the method, an amplification primer ycf1-5 and a forward sequence (5 '-3') are adopted, wherein the forward sequence is TGACCTCTTAACCAGTTTTTCCA; and the reverse sequence (5 '-3') is TGGATTATCAAGGGCATTCCGT. The detection kit is used for detecting SNP1, SNP2 and InDel 1. An amplification primer is ZDJ-190, and the forward sequence (5 '-3') of the amplification primer is AAAGAGCGTGGAGGTTCGAG; and the reverse sequence (5 '-3') is GACTGGGTGGTCGAGTCATG and is used for detecting the InDel 2 site. After the amplification product is sequenced, the SNP1 and SNP2 in the product sequence of the camellia fragrant flower germplasm material primer ycf1-5 are shown as' T 'basic groups; if the InDel 1 lacks the TCTTT sequence, the camellia meiocarpa is the camellia meiocarpa. The InDel 2 site is Vietnam camellia oleifera if the'AGTAC 'sequence is deleted, and the InDel 2 site is common camellia oleifera if the'AGTAC' sequence is not deleted. Therefore, the Vietnam camellia oleifera resources, the Camellia odorata resources, the Camellia microcarpa resources and the common Camellia oleifera resources can be effectively detected and identified, and a technical support is provided for classification identification and molecular breeding selection of related Camellia oleifera resources.
Owner:海南省农业科学院热带园艺研究所

A molecular marker method and application for simultaneously predicting abdominal fat traits, leg bone traits and reproductive performance of broilers

The invention discloses a molecular marking method for simultaneously predicting abdominal fat characters, leg skeleton characters and reproductive performance of broilers and an application, and belongs to the technical field of animal molecular genetics. The invention discloses a method for identifying low-fat broilers more accurately and conveniently and accelerating broiler breeding process. According to the invention, primers are designed according to the sequences from the 208 bp at the upstream to the 72 bp at the downstream of the SNP locus g.3656C > T of the chicken SREBP1 gene exon 3to obtain an amplification primer, then carrying out PCR amplification on the chicken genomic DNA according to the obtained primer, and carrying out enzyme digestion on the amplification product by using restriction endonuclease to obtain the chicken marker genotype. The method is simple to operate, low in cost and high in accuracy, can be used for automatic detection, is an effective molecular marker breeding means, and can be used for accelerating the breeding process of chickens and cultivating low-fat broilers with healthy leg bones and good reproductive performance, which meet market requirements, so that good economic benefits are obtained.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Primer and method for identifying low phytic acid rice mutant zju-lpa2 filial generation genetypes

The invention discloses a primer and a method for identifying low phytic acid rice mutant zju-lpa2 filial generation genetypes, wherein the primer is a primer ZHJ1, a primer ZHJ2 or a combination of the ZHJ1 with the primer ZHJ2. The method includes: (1) extracting total DNA (deoxyribonucleic acid) of leaves of rice samples at the seedling stage; (2) with the total DNA serving as a template, performing PCR (polymerase chain reaction) amplification by the aid of the primer in patent claim 1, subjecting amplified products to gel electrophoretic separation, and imaging after dyeing; and (3) judging the genetypes of the rice samples according to electrophoresis results. The primer co-separated from low phytic acid rice mutant zju-lpa2 can detect the leaves of the rice samples at the seedling stage, so that selection efficiency of LPA (low phytic acid) rice varieties can be greatly improved, and LPA rice breeding process is accelerated.
Owner:ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products