Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

45 results about "Nornicotine" patented technology

Nornicotine is an alkaloid found in various plants including Nicotiana, the tobacco plant. It is chemically similar to nicotine, but does not contain a methyl group. It is a precursor to the carcinogen N-nitrosonornicotine that is produced during the curing and processing of tobacco.

Compositions and methods for minimizing nornicotine synthesis in tobacco

Compositions and methods for reducing the level of nornicotine and N′-nitrosonornicotine (NNN) in tobacco plants and plant parts thereof are provided. The compositions comprise isolated polynucleotides and polypeptides for a root-specific nicotine demethylases, CYP82E10, and variants thereof, that are involved in the metabolic conversion of nicotine to nornicotine in these plants. Compositions of the invention also include tobacco plants, or plant parts thereof, comprising a mutation in a gene encoding a CYP82E10 nicotine demethylase, wherein the mutation results in reduced expression or function of the CYP82E10 nicotine demethylase. Seed of these tobacco plants, or progeny thereof, and tobacco products prepared from the tobacco plants of the invention, or from plant parts or progeny thereof, are also provided. Methods for reducing the level of nornicotine, or reducing the rate of conversion of nicotine to nornicotine, in a tobacco plant, or plant part thereof are also provided. The methods comprise introducing into the genome of a tobacco plant a mutation within at least one allele of each of at least three nicotine demethylase genes, wherein the mutation reduces expression of the nicotine demethylase gene, and wherein a first of these nicotine demethylase genes encodes a root-specific nicotine demethylase involved in the metabolic conversion of nicotine to nornicotine in a tobacco plant or a plant part thereof. The methods find use in the production of tobacco products that have reduced levels of nornicotine and its carcinogenic metabolite, NNN, and thus reduced carcinogenic potential for individuals consuming these tobacco products or exposed to secondary smoke derived from these products.
Owner:NORTH CAROLINA STATE UNIV

Alteration of tobacco alkaloid content through modification of specific cytochrome p450 genes

Compositions and methods for reducing the level of nornicotine and N′-nitrosonornicotine (NNN) in Nicotiana plants and plant parts thereof are provided. The compositions comprise isolated polynucleotides and polypeptides for cytochrome P450s that are involved in the metabolic conversion of nicotine to nornicotine in these plants. Expression cassettes, vectors, plants, and plant parts thereof comprising inhibitory sequences that target expression or function of the disclosed cytochrome P450 polypeptides are also provided. Methods for the use of these novel sequences to inhibit expression or function of cytochrome P450 polypeptides involved in this metabolic conversion are also provided. The methods find use in the production of tobacco products that have reduced levels of nornicotine and its carcinogenic metabolite, NNN, and thus reduced carcinogenic potential for individuals consuming these tobacco products or exposed to secondary smoke derived from these products.
Owner:NORTH CAROLINA STATE UNIV +1

Multi portion intra-oral dosage form and use thereof

The present invention relates to a multi portion intra-oral dosage form where at least one portion is rapidly disintegrating and at least one portion is slowly disintegrating, whereby the disintegration time for the slowest disintegrating portion is at least two times longer than for the most rapidly disintegrating portion. Of certain interest is use of sensory markers / signals as conceptual aids for the subject.Also contemplated are a method and a system for delivering active agents, such as nicotine and / or metabolites thereof, such as cotinine, nicotine N′-oxide, nornicotine, (S)-nicotine-N-β-glucuronide and mixtures, isomers, salts and complexes thereof as well as use and production of said formulations.
Owner:MCNEIL AB

Alteration of tobacco alkaloid content through modification of specific cytochrome P450 genes

Compositions and methods for reducing the level of nornicotine and N′-nitrosonornicotine (NNN) in Nicotiana plants and plant parts thereof are provided. The compositions comprise isolated polynucleotides and polypeptides for cytochrome P450s that are involved in the metabolic conversion of nicotine to nornicotine in these plants. Expression cassettes, vectors, plants, and plant parts thereof comprising inhibitory sequences that target expression or function of the disclosed cytochrome P450 polypeptides are also provided. Methods for the use of these novel sequences to inhibit expression or function of cytochrome P450 polypeptides involved in this metabolic conversion are also provided. The methods find use in the production of tobacco products that have reduced levels of nornicotine and its carcinogenic metabolite, NNN, and thus reduced carcinogenic potential for individuals consuming these tobacco products or exposed to secondary smoke derived from these products.
Owner:NORTH CAROLINA STATE UNIV +1

Multi portion intra-oral dosage form and use thereof

The present invention relates to a multi portion intra-oral dosage form where at least one portion is rapidly disintegrating and at least one portion is slowly disintegrating, whereby the disintegration time for the slowest disintegrating portion is at least two times longer than for the most rapidly disintegrating portion. Of certain interest is use of sensory markers / signals as conceptual aids for the subject.,Also contemplated are a method and a system for delivering active agents, such as,nicotine and / or metabolites thereof, such as cotinine, nicotine N'-oxide, nornicotine, (S)-nicotine-N-ss-glucuronide and mixtures, isomers, salts and complexes thereof as well as use and production of said formulations.
Owner:MCNEIL AB

Method for determining alkaloids in tea leaves by using GC-MS (Gas Chromatography-Mass Spectrometer) method

The invention belongs to the technical field of physiochemical detection of tea leaves and in particular relates to a method for determining alkaloids in tea leaves by using a GC-MS (Gas Chromatography-Mass Spectrometer) method. The method comprises the following step of determining nicotine and minor alkaloids (including nicotine, nornicotine, myosmine, neonicotine, neonicotine and cotinine) in tea leaf powder. The method is a method for extracting nicotine substances from the tea leaves by using a centrifugal tube filled with 0.01% triethylamine / tert-butyl methyl ether solution and analyzing the nicotine substances in the tea leaves by using a gas chromatography-mass spectrometer (GC-MS) method. When the method provided by the invention is used for detecting the content of the nicotine in the tea leaves, the method is rapid and effective, the pre-treatment is simple, an average relative standard deviation is smaller than 10 percent, and the average recycling rate of each index is 86.2 percent to 92.1 percent. The method has the advantages of rapidness and accuracy, high sensitivity and good repeatability.
Owner:CHINA NAT TOBACCO QUALITY SUPERVISION & TEST CENT

Opioid-nornicotine codrugs combinations for pain management

The present invention relates to the field of pain management, and more particularly to synergistic codrugs comprising an opioid and nornicotine which have been combined to form a single chemical codrug entity. When the codrug is administered it produces a synergistic analgesic response to pain.
Owner:UNIV OF KENTUCKY RES FOUND

Multi-portion intra-oral dosage form with organoleptic properties

InactiveCN101843581ASolve the serious problem of high first-pass effectOrganic active ingredientsNervous disorderNornicotineActive agent
The present invention relates to a multi portion intra-oral dosage form comprising at least one pharmaceutically active agent or health promoting agent wherein at least one portion comprises a component for creating a noticeable organoleptic sensation. Of certain interest is use of sensory markers / signals as conceptual aids for a subject using the dosage form whereby the organoleptic sensation / s is / are such that it / they facilitate / s for the subject to identify a portion and differentiate between different portions thereof. Also contemplated are a dosage form, a method and a system for delivering active agents, such as nicotine and / or metabolites thereof, such as cotinine, nicotine N'-oxide, nornicotine, (S)-nicotine-N--glucuronide and mixtures, isomers, salts and complexes thereof as well as use and production of said dosage forms.
Owner:MCNEIL AB

Method for simultaneous chiral resolution and determination of nicotine and nornicotine in electronic cigarette liquid

The invention relates to a method for simultaneous chiral resolution and determination of nicotine and nornicotine in electronic cigarette liquid. The method comprises the following steps: 1) mixing the electronic cigarette liquid with isopropanol and successively carrying out ultrasonic extraction and filtering so as to obtain a to-be-detected solution; and 2) analyzing the to-be-detected solution obtained in the step 1) by using ultra-performance convergence chromatography-tandem mass spectrometry. The method for simultaneous chiral resolution and determination of nicotine and nornicotine in the electronic cigarette liquid is simple in pre-treatment, rapid in determination and high in sensitivity and is a good method for determination of chiral substances in nicotiana alkaloids; and the method does not use any chiral shift reagent, can realizes simultaneous resolution of chiral isomers of the two alkaloids, i.e., nicotine and nornicotine, in the electronic cigarette liquid, and is high in analysis efficiency and friendly to environment.
Owner:CHINA NAT TOBACCO QUALITY SUPERVISION & TEST CENT

Compositions and methods for minimizing nornicotine synthesis in tobacco

Compositions and methods for reducing the level of nornicotine and N′-nitrosonornicotine (NNN) in tobacco plants and plant parts thereof are provided. The compositions comprise isolated polynucleotides and polypeptides for a root-specific nicotine demethylases, CYP82E10, and variants thereof, that are involved in the metabolic conversion of nicotine to nornicotine in these plants. Compositions of the invention also include tobacco plants, or plant parts thereof, comprising a mutation in a gene encoding a CYP82E10 nicotine demethylase, wherein the mutation results in reduced expression or function of the CYP82E10 nicotine demethylase. Seed of these tobacco plants, or progeny thereof, and tobacco products prepared from the tobacco plants of the invention, or from plant parts or progeny thereof, are also provided. Methods for reducing the level of nornicotine, or reducing the rate of conversion of nicotine to nornicotine, in a tobacco plant, or plant part thereof are also provided. The methods comprise introducing into the genome of a tobacco plant a mutation within at least one allele of each of at least three nicotine demethylase genes, wherein the mutation reduces expression of the nicotine demethylase gene, and wherein a first of these nicotine demethylase genes encodes a root-specific nicotine demethylase involved in the metabolic conversion of nicotine to nornicotine in a tobacco plant or a plant part thereof. The methods find use in the production of tobacco products that have reduced levels of nornicotine and its carcinogenic metabolite, NNN, and thus reduced carcinogenic potential for individuals consuming these tobacco products or exposed to secondary smoke derived from these products.
Owner:NORTH CAROLINA STATE UNIV

Method for early evoking and identifying transformant of tobacco nicotine

The invention discloses a method of early inducement identification of converter plants by tobacco smoke alkaloid. Plants are fixed and leaves are picked; any two kinds of or all of potassium bicarbonate, sodium bicarbonate and sodium chloride are mixed at the volume ratio of 1:1 or 1:1:1. The mixture is sprayed, air cured and dried. Nicotine and nornicotine are measured with a gas chromatograph; and the content of the nornicotine in the total quantity of the nicotine and the nornicotine is calculated. If the content of the nornicotine is less than 5 percent, the plants are not converter plants. If the percent conversion of the nicotine is larger than 5 percent, the plants are converter plants; and if the percent conversion of the nicotine is larger than 20 percent, the plants are high converter plants. The technical proposal of the invention has the following advantages: 1. the method adopted by the invention can ensure conversion to be completed within four days; the time is short, and the efficiency is high; 2. the chemical substances adopted by the invention are gentle, and have excellent effect; 3. the chemical substances adopted by the invention are environmentally friendly; 4. the cost of the chemical substances adopted by the invention is far below the cost of the processing method adopting ethephon.
Owner:HENAN AGRICULTURAL UNIVERSITY

Method for chirally analyzing nicotine and nornicotine in tobacco and tobacco products

The invention provides a method for chirally analyzing nicotine and nornicotine in tobacco and tobacco products. The method specifically comprises the following steps: (1) sample pretreatment: obtaining a tobacco powder sample after grinding the tobacco and the tobacco products into powder, adding a NaOH solution and methyl tert-butyl ether into the tobacco powder sample, standing after fully oscillating, and adding an organic solvent for diluting after taking and filtering a supernatant solution, thus obtaining a to-be-detected solution; (2) sample detection: carrying out ultrahigh performance convergence chromatography-tandem mass spectrum detection on the to-be-detected solution, and determining relative contents of chiral components of the nicotine and the nornicotine in the tobacco and the tobacco products by adopting a peak area normalization method. According to the method for chirally analyzing the nicotine and the nornicotine in the tobacco and the tobacco products, provided by the invention, the nicotine and the nornicotine are used as research objects, optimization treatment is carried out on the tobacco and the tobacco products, a separating effect is good, the sensitivity is high, the repeatability is good, and determination on the chiral components of the nicotine and the chiral components of the nornicotine can be realized.
Owner:SHANGHAI TOBACCO GRP CO LTD

Primer pair and method for identifying low-nornicotine mutant filial generation genotype of tobacco

The invention discloses a primer pair for identifying the low-nornicotine mutant filial generation genotype of tobacco. The primer pair is characterized in that the primer 1 is a sequence as shown inSeq ID No.1, namely 5'GATGAGATGTGTGCATACTTG3', and the primer 2 is a sequence, namely 5'CCAAATTAGAAAAACTCGTACTG3', as shown in Seq ID No.2. The primer pair combined with HRM can be used for screeninga great quantity of filial generation populations, and effectively differentiating non-mutant, mutant hybrid and mutant homozygote, so that materials containing tobacco CYP82E4 mutant genes can be accurately and efficiently identified.
Owner:GUIZHOU TOBACCO SCI RES INST +1

Method for measuring content of nornicotine enantiomers in electronic cigarette liquid with hybrid-phase chromatography-tandem MS (mass spectrometry)

The invention discloses a method for measuring content of nornicotine enantiomers in an electronic cigarette liquid with hybrid-phase chromatography-tandem MS (mass spectrometry). The method is characterized by comprising steps as follows: after being wetted with a sodium hydroxide solution, an electronic cigarette liquid sample is extracted with dichloromethane, an extraction liquid after being subjected to matrix dispersive solid-phase extraction and purification is analyzed with two-chiral-column series-connection-hybrid phase chromatography-tandem MS, and a ratio of S-nornicotine to R-nornicotine in the electronic cigarette liquid is detected quantitatively with a peak area normalization method. According to the detection method, the sample extraction and purification method is simple and efficient, pollution of the sample liquid to a chromatographic column can be reduced, and the detection method based on the hybrid-phase chromatography-tandem MS is high in sensitivity, good in specificity and short in analysis time, can remove false positive and can meet the requirement of chiral analysis for nornicotine in mass electronic cigarette liquid samples.
Owner:CHINA NAT TOBACCO QUALITY SUPERVISION & TEST CENT

Method for extracting alkaloid by utilizing waste water and sludge of tobaccos

The invention relates to a method for extracting alkaloid by utilizing waste water and sludge of tobaccos, which can ensure that waste water and sludge of the tobacco industry, particularly waste water and sludge of tobacco sheets can be reasonably utilized. According to basic group activation and calcium group replacement principles, a pretreating agent is added to sludge, and the alkaloid extraction is realized through a positive-reverse cycling extraction process of alternately carrying out solvent extraction and dilute acid elution. The method mainly comprises the following steps of: pretreating sludge; drying and pulverizing; extracting the solvent; and eluting with dilute sulphuric acid, wherein the alkaloid extraction ratio is 1-3 percent of the dry weight of the sludge; and measured by a high performance liquid chromatography (HPLC), the main ingredient (occupies 80 percent) of the extractive is nicotine sulfate, and the rest alkaloid ingredients are all nicotine homologues and derivatives, which can be alkaloids such as isonicotine, nornicotine, and the like. The solvent used in the method of the invention has no color, taste and toxicity, low flammability, relative safety, no influence on environment, extremely low process loss rate and recycling capability.
Owner:WUHAN DANYAXIANG TECH DEV

Method for detecting 4-hydroxyl-4-(3-pyridyl) butyric acid in urine

The invention discloses a method for detecting 4-hydroxyl-4-(3-pyridyl) butyric acid in urine. The method comprises the following steps: purifying a urine sample by using an Oasis MCX solid-phase extraction small column; carrying out methyl esterification on carboxyl in the sample and carrying out esterification on alcoholic hydroxyl; then carrying out HPLC-MS-MS (High Performance Liquid Chromatography-Mass Spectrometry-Mass Spectrometry) detection on a derived urine sample so as to calculate the concentrations of (S)-4-hydroxyl-4-(3-pyridyl) butyric acid and (R)-4-hydroxyl-4-(3-pyridyl) butyric acid in the urine sample; and calculating a ratio of the (S)-4-hydroxyl-4-(3-pyridyl) butyric acid to the (R)-4-hydroxyl-4-(3-pyridyl) butyric acid in the urine sample. The method can provide a scientific judgment method for estimating metabolism health conditions to nicotine, nornicotine, NNK (Nicotine-derived Nitrosamine Ketone) and NNAL ((4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol)) by an individual body, and evaluating the exposure degree to substances in smoke, has the advantages of low detection limit, good stability, rapidness and accuracy and the like, and fills the blank of the technical field.
Owner:HONGYUN HONGHE TOBACCO (GRP) CO LTD

Breeding method capable of reducing conversion rate of tobacco nicotine

The invention provides a breeding method capable of reducing the conversion rate of tobacco nicotine. The breeding method is characterized in that the advantages of the first generation of the male sterile hybrid are utilized, the materials comprise male sterile female parent and a maintainer line as well as male parent, the tobacco nicotine conversion rates of the male sterile hybrid female parent and the maintainer line as well as the male parent need to be smaller than 5%, the tobacco nicotine conversion rates of the male sterile hybrid female parent and the maintainer line need to be smaller than the tobacco nicotine conversion rate of the male parent; the male sterile female parent and maintainer line and the male parent with the tobacco nicotine conversion rates higher than 5% need to be subjected to selection and purification of the tobacco nicotine; the selection and purification of the tobacco nicotine of the male sterile hybrid female parent with the tobacco nicotine conversion rate higher than 5% comprise the synchronous purification of the male sterile female parent and the maintainer line. According to the method, the tobacco nicotine conversion rate character has negative hybrid advantage in the hybridization process, namely, the tobacco content of the hybrid F1 is more than a parent average value, the nornicotine is greatly lower than the parent average value, the parent with lowest nicotine conversion rate is taken as a hybrid female parent, the hybrid advantage is maximum, the operation is simple, and the effect is obvious.
Owner:HUBEI TOBACCO SCI RES INST

Method for asymmetrically synthesizing (S)-nicotine

The invention provides a method for asymmetrically synthesizing (S)-nicotine. The method comprises the following steps: condensing 3-pyridylaldehyde and (R)-tert-butanesulfinamide to obtain chiral imine; adding ethyl acetoacetate to react with the chiral imine to obtain chiral amine; removing tert-butyl sulfinyl and ester group from the chiral amine to obtain chiral aminoketone; protecting the amino group of the chiral aminoketone by using phthalic anhydride; adding a brominating agent to brominate the chiral aminoketone to obtain bromide; and adding hydrazine hydrate to remove a Pht protecting group and form a tetrahydropyrrole ring at the same time by utilizing a one-pot method, reducing carbonyl into methylene to obtain (S)-nornicotine, and carrying out N-methylation on the (S)-nornicotine to obtain the final product (S)-nicotine. According to the method, direct construction of chiral carbon is realized by utilizing a cheap chiral reagent (R)-tert-butanesulfinamide, (S)-nicotine with high chiral purity is obtained at a relatively high yield through subsequent simple reaction steps, and the method is simple, convenient, feasible and suitable for industrial production.
Owner:云南萃精生物科技有限责任公司

Method for determinating nornicotine enantiomer content of smoke-free tobacco product by combined phase chromatography-tandem mass spectrometry

InactiveCN107228914AChiral analysis meetsAchieve baseline separationComponent separationNornicotineEnantiomer
The invention discloses a method for determinating the nornicotine enantiomer content of a smoke-free tobacco product by a combined phase chromatography-tandem mass spectrometry. The method is characterized by comprising the following steps: drying, crushing and sieving a smoke-free tobacco product sample, infiltrating the sample by using a sodium hydroxide solution, extracting by using dichloromethane, purifying an extract through matrix solid-phase dispersion extraction, analyzing by two tandem chiral columns-combined phase chromatography-tandem mass spectrometry, and quantitatively detecting a ratio of S-nornicotine to R-nornicotine in the smoke-free tobacco product by a peak area normalization method. According to the method provided by the invention, the sample extracting and purifying method is simple and efficient, pollution of sample liquid to the chromatographic columns can be reduced, the combined phase chromatography-tandem mass spectrometry detection method is high in sensitivity and good in specificity, false positive can be excluded, the analysis time is short, and chiral analysis on the nornicotine in a large batch of smoke-free tobacco product samples can be met.
Owner:CHINA NAT TOBACCO QUALITY SUPERVISION & TEST CENT

Nicotine converted tobacco plant color quality rapid screening method based on incubation treatment

The invention discloses a nicotine converted tobacco plant color quality rapid screening method based on incubation treatment. The method comprises the steps of seedling sampling, alkaloid extraction,sample incubation, instrument analysis and data analysis. The tobacco leaves are hatched and cultured without needing to add an activator and control the humidity, and a tobacco seedling and tobaccoleaf sample is placed in a closed container to be incubated for 10-12 hours, so that the alkaloid extraction and analysis can be carried out. According to the experiment, the humidity of the incubation reaction does not need to be additionally controlled, and the activator does not need to be added, so that the reaction condition is simplified, the incubation reaction can be carried out in any temperature-controllable environment, the incubation time is greatly shortened, and the working efficiency is improved. According to the invention, thealkaloid content analysis is carried out by using agas chromatograph-mass spectrometer, and the contents of nicotine and nornicotine can be determined within 5-6 minutes, so that a PNC value is obtained, and the analysis time of a sample solution is shortened. According to the invention, the PPNC is introduced as a simplified scheme of the PNC, is easier to obtain than the PNC and is not influenced by the factors, such as standard substance purity, standard curve quality, etc.
Owner:YUNNAN ACAD OF TOBACCO AGRI SCI

Method for reducing nornicotine content in leaves of burley tobacco Eyan No.3

InactiveCN105165598AReduced nornicotine contentEnsure germplasm qualityPlant genotype modificationBiotechnologyNornicotine
The present invention discloses a control method of nornicotine content in leaves of burley tobacco Eyan No.3. The method is as below: continuously screening parents of burley tobacco Eyan No.3 for 2-3 generations; selecting a female parent MSTN86 with low nicotine conversion of Eyan No.3 and a maintainer line TN86 tobacco plant; and screening the current generation Eyan 3 LAB21 male parent through breeding (under permitting conditions also screening parental filter); screening a male parent and a female parent with low nicotine conversion, and conducting cross-breeding. The method effectively controls the germplasm quality of Eyan No., reduces the nornicotine content of tobacco after air-curing, and improves the safety of tobacco.
Owner:CHINA TOBACCO GUANGXI IND

Synthesis process of nicotine with single configuration

The invention discloses a synthesis process of nicotine with a single configuration, which comprises the following steps: under the protection of nitrogen, taking myosmin as a substrate, and selectively reducing the myosmin in an organic solvent by using a copper salt-chiral organic ligand-hydrogen source catalytic system for the first time to obtain the nicotine with the single configuration. The single-configuration nornicotine is subjected to an aminomethylation reaction to obtain single-configuration nicotine. According to the synthesis process of the single-configuration nicotine, disclosed by the invention, the reaction time is shortened, the high-optical-purity single-configuration nornicotine is obtained through the asymmetric catalytic reduction reaction, the high-optical-purity nicotine is further obtained, and the total synthesis yield is improved.
Owner:DALIAN TRICO CHEM

Opioid-Nornicotine Codrugs Combinations for Pain Management

The present invention relates to the field of pain management, and more particularly to synergistic codrugs comprising an opioid and nornicotine which have been combined to form a single chemical codrug entity. When the codrug is administered it produces a synergistic analgesic response to pain.
Owner:UNIV OF KENTUCKY RES FOUND

Chiral analysis bonded phase chromatography-tandem mass spectrometry method for detecting nicotine and nornicotine in smokeless tobacco product

The invention discloses a chiral analysis bonded phase chromatography-tandem mass spectrometry method for detecting nicotine and nornicotine in a smokeless tobacco product. The chiral analysis bonded phase chromatography-tandem mass spectrometry method is characterized in that a sample of the smokeless tobacco product is dried, crushed and sieved, is soaked in a sodium hydroxide solution and is extracted by an n-hexane / methyl alcohol solution, an extract liquid is subjected to matrix dispersion solid-phase extraction and purification and is analyzed by using two series connection chiral columns and the bonded phase chromatography-tandem mass spectrometry, and the proportions of S-(-)-nicotine, R-(+)-nicotine, S-(-)-nornicotine and R-(+)-nornicotine in the smokeless tobacco product are detected quantitatively according to a peak area normalization method. According to the provided detecting method, the sample extracting and purifying method is simple and efficient, the pollution of a chromatographic column, caused by a sample liquid, is reduced, the bonded phase chromatography-tandem mass spectrometry detecting method is high in sensitivity and good in specificity and can exclude the false positive reaction, the analysis time is short, and the chiral analysis of nicotine and nornicotine in the mass samples of the smokeless tobacco product is realized.
Owner:CHINA NAT TOBACCO QUALITY SUPERVISION & TEST CENT

Nornicotine degrading bacteria and microbial agent produced by same

The invention discloses nornicotine degrading bacteria and a microbial agent produced by the same. The nornicotine degrading bacteria is a gram-positive Pseudarthrobacter sp. strain W1-1 collected ina China Center for Type Culture Collection, and the collection number of the strain is CCTCC NO. M 2018758. The strain W1-1 can degrade nornicotine, the nornicotine degrading microbial agent producedby the strain has the advantages of low production and use cost, convenience in use and good removing effects and is suitable for being used in a biochemical treatment tank for tobacco processing enterprise wastewater. The starting time of a biochemical treatment system can be shortened, nornicotine degrading effects are improved, nornicotine removing rate is kept above 95%, and the nornicotine degrading bacteria have an excellent application prospect and great significance for protecting ecological environments and physical health of people.
Owner:镇江蔚绿生物科技有限公司

Method of measuring content of nornicotine enantiomer in cigarette cut tobacco through bonded phase chromatography-tandem mass spectrometry

InactiveCN107247107AChiral analysis meetsReduce pollutionComponent separationNornicotineEnantiomer
The invention discloses a method of measuring content of nornicotine enantiomer in cigarette cut tobacco through bonded phase chromatography-tandem mass spectrometry. The method is characterized in that a cigarette cut tobacco sample is dried, smashed and screened, after being soaked in sodium hydroxide solution, the sample is extracted with dichloromethane, after matrix solid-phase dispersion is carried out on extract liquid, two-chiral-column tandem-bonded phase chromatography-tandem mass spectrometry is used for analysis, and a peak area normalization method is used for quantitatively determining the ratio of S-nornicotine and R-nornicotine in the cigarette cut tobacco. According to the provided detection method, the sample extracting and purifying method is simple and efficient, contamination to chromatographic columns by the sample liquid can be reduced, and the bonded phase chromatography-tandem mass spectrometry is high in sensitivity and specificity, capable of eliminating false positive, short in analysis time and capable of meeting the requirement of chiral analysis of nornicotine in cigarette cut tobacco samples in batches.
Owner:CHINA NAT TOBACCO QUALITY SUPERVISION & TEST CENT

Preparation method and applications of novel imprinting gas chromatography stationary phase

The invention discloses a nicotine multi-component simultaneous imprinting composite material microsphere preparation method and applications of the microspheres as a gas chromatography stationary phase in separation analysis of difficult-to-separate components in smoke. According to the invention, a composite imprinting material is prepared by using a sulfydryl-modified metal organic framework asa carrier and using a plurality of nicotine mixtures as a common template, a chromatographic column is prepared from the composite imprinting material, and nicotine, nornicotine and neonicotine can be effectively separated under optimized chromatographic conditions, wherein the volume factors of nicotine, nornicotine and neonicotine are respectively 117.8+ / -9.01, 83.55+ / -4.03 and 71.82+ / -5.18; and the obtained material as a gas chromatography stationary phase has selective retention and separation capability on compounds such as nicotine, nornicotine, anabasine and the like in smoke so as toprovide a new method for separation analysis of difficult-to-separate compounds in smoke.
Owner:JISHOU UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More