Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

361results about How to "High polymorphism" patented technology

Microsatellite loci of portunus trituberculatus and primer

The invention aims at providing microsatellite loci of portunus trituberculatus and a polymorphic primer, namely providing five microsatellite loci of portunus trituberculatus. A nucleotide sequence of the microsatellite loci is any one of SEQ ID NO:1 to 5. The invention also provides a primer designed from the microsatellite loci. The primer is used for genetic diversity detection of portunus trituberculatus population. By adopting the microsatellite loci of portunus trituberculatus, five microsatellite loci are screened from a public database of the portunus trituberculatus; a specific primer is designed according to flanking sequences at two ends of the microsatellite; the amplification result has high polymorphism and stability. The primer can be applied to the fields such as genetic diversity detection and relationship identification of the portunus trituberculatus population, building of a genetic linkage map, and assistant breeding of a molecular marker.
Owner:NINGBO UNIV

Construction and identification method of molecular marking fingerprint of Dendrobium huoshanense and similitude species thereof

The invention relates to a method for constructing and identifying molecular marker fingerprint chromatogram of Dendrobium huoshanense and similar species thereof, which solves the problems that a method of identifying medicinal plants in the prior art has high cost, complicated procedures and long time consumption. The method comprises the steps of: 1, the collection of Dendrobium huoshanense samples; 2 the extraction and purification of DNA of genomes of the samples; 3. ISSR-PCR amplification; 4, agarose gel electrophoresis; 4, the construction of ISSR molecular marker fingerprint chromatogram of the samples to be tested; and 5, the identification of Dendrobium huoshanense germplasm by utilizing the constructed ISSR molecular marker fingerprint chromatogram. The method has the advantages that the method saves the time and the cost, and can obtain an accurate and reliable identification chromatogram through the extraction to DNA of Dendrobium plants, the ISSR-PCR amplification, and the agarose gel electrophoresis; the method has the advantages of simplicity, convenience, quickness, good repetitiveness, and high resolution on the identification of raw materials which are easy to confuse in appearance; and the method can identify in a seedling stage, which has important effect on ensuring the accuracy and stability of base resources of medicinal materials.
Owner:陈乃富

Method for constructing China asparagus bean genetic resource database based on ISSR molecular marker and uses thereof

The invention discloses an ISSR molecular marking based method for constructing a Chinese asparagus bean generic resource database and application thereof. The invention also utilizes the data base to identify the trueness of a variety; according to field forms, the consistency and typicality among individual plants of the variety are identified, separated and atypical materials are given up, and DNA of the individual plant of the consistent and typical variety is picked up; by utilizing three ISSR markings with high polymorphism, the consistency of DNA level among the individual plants is primarily selected, and the variety and individual plant constructing a fingerprint are finally determined; and by utilizing the finally selected variety and individual plant, the ISSR analysis of the Chinese asparagus bean is made to construct a fingerprint database. The invention overcomes the defects existing in the construction of the prior generic resource database, such as separation among different individual plants of the variety and impurity on the DNA level, the reliability and accuracy of the Chinese asparagus bean ISSR fingerprint data base constructed by the method are greatly improved, and the planting varieties of the Chinese asparagus bean can be effectively and conveniently identified and distinguished.
Owner:JIANGHAN UNIVERSITY

SSR core primer group developed based on sesame complete genomic sequence and application

The invention discloses a SSR core primer group developed based on sesame complete genomic sequence and application. The primer group comprises 32 pairs of primers, and the nucleotide sequences are shown as the sequence SEQ ID NO. 1-64. The obtained SSR core primer group has the advantages of being capable of furthest reflecting the heredity diversity of sesame germplasm resource materials, high in polymorphism, good in repeatability, stable in mark, easy for discrimination statistics and the like, is applicable to the fields of sesame variety identification, sesame variety heredity pedigree analysis and sesame variety germplasm resource heredity diversity evaluation and the like; and the primer group can be utilized to perform sesame heredity diversity analysis, and the heredity genetic relationship of a to-be-tested material can be furthest accurately reflected.
Owner:INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI

Method for developing functional molecular marker related to miRNA

The invention discloses a method for developing a functional marker related to MicroRNA (miRNA for short). The method comprises the following steps of: performing BlastN comparison on a known miRNA sequence in an miRNA database with a disclosed DNA sequence of a researched species; determining a DNA (miDNA for short) sequence corresponding to the miRNA based on the number and a similarity degree of base mismatch; extending to the left and right for a certain distance until the total length is about 150bp; determining a precursor miDNA site through prediction of a stem loop secondary structure and calculation of the minimum free folding energy coefficient; classifying and comparing all screened precursor miRNA sequences; designing primers according to conserved sequences; electronically comparing the designed primers in the database, and determining as miRNA special sequences; and finally combining according to an annealing temperature of each primer, and developing the functional marker with high efficiency and good polymorphism. The marker system integrates the advantages of the conventional markers such as simple sequence repeat (SSR), amplified fragment length polymorphism (AFLP) and the like, and has good characteristics of higher portability, low cost, polymorphism and stability and the like.
Owner:SOUTHWEST UNIVERSITY

Molecular marker of sesame dominant genic male sterility gene and preparation method and application thereof

InactiveCN103993011ADoes not change genetic structureHigh number of tagsMicrobiological testing/measurementDNA/RNA fragmentationForward primerAgricultural science
The invention discloses a molecular marker of sesame dominant genic male sterility gene and a preparation method and application thereof. A forward primer sequence of the marker GB50 is ATGGGTTTATGGCAGGCT, and a reverse primer sequence is GGACTACTCCTCCTCCCCA; a forward primer sequence of SBM298 is CCCCTTTTCACTTACGTACAGCAG, and a reverse primer sequence is CTCTTCCTCCACCATCTCCTCTTC. The preparation method comprises the steps of: A, respectively numbering dominant genic male sterility brother-sister inbreeding segregation population in the seedling stage, collecting tender leaves from each individual plant, treating by liquid nitrogen and storing in a refrigerator for standby; B, conducting biosynthesis by using EST-SSR primers of SBM series; C, amplifying by a PCR procedure; D, conducting PCR amplification and product detection; E, acquiring a polymorphism marker; and F, acquiring a molecular marker associated with male sterility. The method can obtain 100% male sterility population, significantly improve the efficiency of sesame recurrent selection, and avoid the trouble of eradication of 50% fertile plants until the flowering phase by using morphological characteristics. The invention has obvious effect, low cost, no pollution and very broad application prospects.
Owner:INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI

Method for identifying varieties of lilium brownii by adopting SSR (simple sequence repeat) molecular marking technology

The invention relates to the method for identifying the varieties of lilium brownii by adopting an SSR (simple sequence repeat) molecular marking technology. A result shows that: two pairs of high-polymorphism and high-repeatability primers are screened from 13 pairs of primers for detecting 171 fragments comprising 131 polymorphic fragments, 4 to 22 fragments can be detected by each pair of primers with the sizes of 100 to 250bp, 1.69 bands are amplified by each pair of primers, and the polymorphism rate is 76.70 percent; NTSYS-pc2.11 is used for similarity coefficient and cluster analysis, the genetic similarity coefficient is 0.5882 to 09412, and the average similarity coefficient is 0.7647; materials are divided into six major classes by cluster analysis, the genetic differences between 11 lilium brownii germplasms are irrelevant to varietal characteristics, flower forms, the colors of filaments and styluses, but have certain correlation with the colors of petals, flower genes can better reflect genetic relationships between the lilium brownii germplasms, different varieties have different colors, and the primers can be designed by controlling related genes of flowers to provide an important means for further distinguishing the genetic relationships.
Owner:KAILI UNIV

Fluorescent-marked 16 X-STR loci multiplex amplification system and application thereof

The invention belongs to the technical field of bioinstrumentation, in particular to a fluorescent-marked 16 X-STR loci multiplex amplification system and application thereof. The system performs multiplex amplification analysis on 16 X-STR loci, namely GATA165B12, DXS101, GATA172D05, HPRTB, DXS981, DXS8378, DXS6795, GATA31E08, DXS6809, DXS6803, DXS9902, DXS6807, DXS7423, DXS7133, DXS6810 and DXS7132; the 16 loci are independent relatively and not linked mutually; and corresponding primers are respectively marked by four fluorescent markers, namely FAM, HEX, TAMRA and ROX. Based on the multiplex amplification system, an X-STR loci multiplex amplification kit suitable for Chinese people can be prepared for parentage analysis, individual recognition, sex tests, and gene location of X-linked inheritance disease, particularly for paternity identification of sisters, blooded half-sisters and skipped generations.
Owner:司法部司法鉴定科学技术研究所

Peach SSAP (Source Service Access Point) molecular marker primer combination, molecular marker combination and application of molecular marker combination in analysis on genetic diversity of peach varieties

The invention discloses a peach SSAP (Source Service Access Point) molecular marker primer combination, a peach SSAP molecular marker combination and an application of the peach SSAP molecular marker combination in analysis on the genetic diversity of peach varieties, wherein the peach SSAP molecular marker primer combination comprises an LTR (Long Terminal Repeat) primer, a selective amplification primer and a tail primer; the peach SSAP molecular marker combination comprises ten molecular markers JY01, JY02, JY03, JY04, JY05, JY06, JY07, JY08, JY09 and JY10. Due to the design of a peach retrotransposon LTR sequence primer, a selective amplification product is proved to be clear and abundant in amplification strip and have high efficiency, reliability and practicability through fluorescent capillary electrophoresis detection; in addition, a selective amplification PCR (Polymerase Chain Reaction) system is optimized, and a tail sequence is added, so that the traditional selective amplification PCR system is improved, and the cost for carrying out relevant researches by using the molecular markers is reduced. The SSAP molecular marker combination disclosed by the invention has relatively high polymorphism in the plurality of peach varieties, comprises stably existing markers and can be used for peach variety identification and genetic diversity analysis.
Owner:JIANGSU ACAD OF AGRI SCI

Fluorescent labeled X-STR gene locus multiplex PCR method and application thereof

The invention discloses a fluorescent labeled X-STR locus multiplex PCR method and an application thereof; the system performs multiplex amplification analysis of 12 loci: GATA172D05, DXS6789, DXS10074, DXS10078, GATA165B12, DXS6797, DXS6803, DXS6804, GATA31E08, DXS7130, DXS9895, and DXS6810, wherein primers of the 12 loci are labeled respectively by four fluorescences of FAM, HEX, TAMRA, ROX. The method of the invention can be used to prepare a set of kit as an X-STR locus multiplex amplification kit with Chinese characteristics, and the kit is applicable to gene localization of paternity identification, individual identification, sex identification, and X-linked genetic diseases, and is especially applicable to paternity identification for sister recognition, half-blood half-sister recognition, generation-skipping recognition, etc.
Owner:SUN YAT SEN UNIV

Screening and application of solanum melongene SSR (Simple Sequence Repeats) molecular marker core primers

The invention discloses screening and application of solanum melongene SSR (Simple Sequence Repeats) molecular marker core primers. A solanum melongene SSR molecular marker core primer group comprises17 SSR molecular marker core primer pairs. The stable and reliable solanum melongene SSR primers with high polymorphism are screened by extracting DNA and SSR-PCR of solanum melongene core germplasmswith great property differences. The screened 17 SSR primer pairs are used for analyzing 106 parts of solanum melongene culture variety resources; through similarity calculation and clustering analysis, the result shows that the screened 17 pairs of primers can be used for accurately and efficiently identifying the solanum melongene variety; and the foundation is laid for the application of an SSR molecular marker technology to solanum melongene germplasm genetic relationship analysis and variety identification.
Owner:SHANGHAI ACAD OF AGRI SCI

Floral character associated molecular marker screening method of amenone form chrysanthemum and application of method

The invention belongs to the biotechnical field and provides a floral character QTL (quantitative trait locus) molecular marker screening method of amenone form chrysanthemum. The method can be used for positioning and cloning excellent genes of floral characters of amenone form chrysanthemum and cultivating novel varieties of amenone form chrysanthemum. The method comprises the following steps: I, obtaining a test material and phenome data; II, constructing a linkage map of chrysanthemum; III, combining phenome data with a molecular genetic map for QTL analysis of floral characters of amenone form chrysanthemum; and IV, determining the floral character associated molecular marker of the amenone form chrysanthemum. By using 160 F1 segregation population which is obtained by taking an amenone form chrysanthemum variety QX-053 as a female parent and a non-menone form chrysanthemum variety Nannongjingyan as a male parent, a plurality of molecular markers which are remarkably associated with floral characters of amenone form chrysanthemum. The molecular markers which are associated with floral characters of amenone form chrysanthemum are obtained for fine-mapping and cloning excellent genes of floral characters of amenone form chrysanthemum so as to greatly improve the selection efficiency, so that the amenone form chrysanthemum cultivating process is accelerated.
Owner:NANJING AGRICULTURAL UNIVERSITY

Genetic marker for human individual recognition and/or paternity identification and detection method thereof and kit

The invention discloses a genetic marker combination for human individual recognition and / or paternity identification and a detection method thereof. By conducting whole-genome SNPs unbiased scanningon multiple races, a SNPs site combination widely applicable to the multiple races is screened, and 116 autosome SNPs sites which come from 37 groups in different regions in the whole world, have thehypermorph allel frequency and low difference and achieve independent inheritance and 12 X chromosome SNPs sites which come from 37 groups in different regions in the whole world, have the hypermorphallel frequency and low difference and achieve independent inheritance are screened from 25,580,678 SNPs sites in a genome-wide scale. Compared with an existing commercial kit, the SNPs site combination has higher and wider multiracial adaptation, the cumulative individual recognition probability and the cumulative probability of exclusion are both significantly superior to those of the commercialkit, the detection result is more accurate, and a great application prospect is achieved.
Owner:SUN YAT SEN UNIV

Method for designing, amplifying and sequencing twelve pairs of floccularia luteovirens microsatellite primers

The invention relates to a method for designing, amplifying and sequencing twelve pairs of floccularia luteovirens microsatellite primers. The method comprises the following steps: (1) extracting genome DNA of three floccularia luteovirens populations among which the geographic interval is more than 300km by using an improved CTAB method; (2) randomly selecting an individual genome DNA respectively from the three populations, mixing, detecting the quality of total DNA, preparing a gene library, and performing Illumina HiSeq<TM>2500 sequencing after the gene library is qualified in examination in depot; (3) splicing sequenced data, detecting simple sequence repeats (SSR) in the total DNA sequence by using SR search software, and performing primer design by applying primer3; (4) preparing an SSR primer having an annealing temperature of 50-60 DEG C by adopting a temperature gradient method; (5) respectively performing PCR amplification on the genome DNA of the three floccularia luteovirens populations, and sequencing and verifying to obtain 12 pairs of primers with polymorphism; and (6) calculating the number N of allelic genes, haplotype diversity H<d> genetic differentiation coefficient F<ST>, nucleotide diversity P, G<ST> and the value of pi. The method is beneficial to large-scale research.
Owner:CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products