Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

134results about How to "Good polymorphism" patented technology

Screening and application of solanum melongene SSR (Simple Sequence Repeats) molecular marker core primers

The invention discloses screening and application of solanum melongene SSR (Simple Sequence Repeats) molecular marker core primers. A solanum melongene SSR molecular marker core primer group comprises17 SSR molecular marker core primer pairs. The stable and reliable solanum melongene SSR primers with high polymorphism are screened by extracting DNA and SSR-PCR of solanum melongene core germplasmswith great property differences. The screened 17 SSR primer pairs are used for analyzing 106 parts of solanum melongene culture variety resources; through similarity calculation and clustering analysis, the result shows that the screened 17 pairs of primers can be used for accurately and efficiently identifying the solanum melongene variety; and the foundation is laid for the application of an SSR molecular marker technology to solanum melongene germplasm genetic relationship analysis and variety identification.
Owner:SHANGHAI ACAD OF AGRI SCI

Floral character associated molecular marker screening method of amenone form chrysanthemum and application of method

The invention belongs to the biotechnical field and provides a floral character QTL (quantitative trait locus) molecular marker screening method of amenone form chrysanthemum. The method can be used for positioning and cloning excellent genes of floral characters of amenone form chrysanthemum and cultivating novel varieties of amenone form chrysanthemum. The method comprises the following steps: I, obtaining a test material and phenome data; II, constructing a linkage map of chrysanthemum; III, combining phenome data with a molecular genetic map for QTL analysis of floral characters of amenone form chrysanthemum; and IV, determining the floral character associated molecular marker of the amenone form chrysanthemum. By using 160 F1 segregation population which is obtained by taking an amenone form chrysanthemum variety QX-053 as a female parent and a non-menone form chrysanthemum variety Nannongjingyan as a male parent, a plurality of molecular markers which are remarkably associated with floral characters of amenone form chrysanthemum. The molecular markers which are associated with floral characters of amenone form chrysanthemum are obtained for fine-mapping and cloning excellent genes of floral characters of amenone form chrysanthemum so as to greatly improve the selection efficiency, so that the amenone form chrysanthemum cultivating process is accelerated.
Owner:NANJING AGRICULTURAL UNIVERSITY

EST-SSR core primer group for identifying variety of Chinese wolfberry and identification method and application thereof

The invention discloses an EST-SSR core primer group for identifying the variety of Chinese wolfberry and an identification method and an application thereof. Through screening of EST sequences of lycium ruthenicum and Ningxia wolfberry, a large number of SSR molecular markers are developed, and an SSR marker-meeting fluorescence detection technology system including 10 markers is established and is used for identification of the Chinese wolfberry variety and species. The 10 markers have the advantages of good polymorphism, stable amplification, clear amplification results and good repeatability, can be used for large-scale detection of authenticity of Chinese wolfberry seedlings and the purity of the seedlings, can provide a technical basis for standardization of seedling markets, and are conducive to development and use of the traditional Chinese medicine Chinese wolfberry.
Owner:SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI

Obtaining method and application of molecular markers related to chrysanthemum drought resistance

InactiveCN104498475AShort attenuation distancePrecise positioningMicrobiological testing/measurementDNA preparationResistant genotypeAgricultural science
The invention belongs to the biotechnology field, provides an obtaining method of molecular markers related to chrysanthemum drought resistance, and is used for positioning and cloning of a chrysanthemum drought resistance excellent gene and breeding of new chrysanthemum varieties. The obtaining method comprises the steps: a, identification of the drought resistance; b, analysis of a chrysanthemum variety group structure; c, analysis of chrysanthemum variety genetic relationship; and d, determination of the molecular markers closely related to the chrysanthemum drought resistance. The method simultaneously adopts three molecular marker techniques comprising SRAP, SCoT and EST-SSR, the principles are different with each other and each have pertinency, and obtained dyeing strips are good in polymorphism and high in repeatability, can cover the entire genome, have rich number of strips and are beneficial for obtaining the molecular markers closely related to the drought resistance. 8 molecular markers related to the chrysanthemum drought resistance are totally obtained, early selection, directional selection and accurate selection of excellent drought-resistant varieties are achieved, the work load can be reduced, and the selection efficiency of chrysanthemum drought resistant genotypes is greatly improved, so as to speed up the process of breeding.
Owner:NANJING AGRICULTURAL UNIVERSITY

Set of SNP sites suitable for identifying variety and purity of hops and applications of set of SNP sites

The invention discloses a set of SNP sites suitable for identifying the variety and purity of hops. The set of SNP sites comprises five SNP sites for hops totally. Based on a whole genome sequencing result for 10 representative hop varieties at home and abroad, comparison and screening are carried out on the SNP sites of the whole genome, at present, the identification for the variety and purity of hops of 5 SNP sites with relatively good polymorphism is verified, the 5 SNP sites can identify the variety of the hops, meanwhile, a genotype result is stable, and after the follow-up verification work for the authenticity of the SNP sites is completed, an SNP site fingerprint database of the hops is complemented to be complete. With the SNP sites and the identification method provided by the invention, an identification system for the variety and the purity of hops, which realizes low cost, high efficiency and standardization is provided for the beer production industry.
Owner:CHINA NAT RES INST OF FOOD & FERMENTATION IND CO LTD

Amaranth EST-SSR marker primer and method for identifying amaranth varieties

The invention provides an amaranth EST-SSR marker primer and a method for identifying amaranth varieties. The nucleotide sequence (CATA)5F of the amaranth EST-SSR marker (CATA)5 is CACGTCCTTCATTCGGATCT, and the nucleotide sequence (CATA)5R of the amaranth EST-SSR marker (CATA)5 is AATCCCGGAGGTAGGATCAC. The amaranth EST-SSR marker (CATA)5 has good polymorphism among the amaranth varieties and is clear in spectrum band and stable and reliable. The amaranth EST-SSR marker (CATA)5 is also applicable to germplasm resource identification and genetic diversity analysis of more amaranth plants.
Owner:FUJIAN AGRI & FORESTRY UNIV

Scophthalmus maximus T170G single nucleotide polymorphic marking detection method

The invention relates to a scophthalmus maximus T170G single nucleotide polymorphic marking detection method. The method comprises the following steps: extracting scophthalmus maximus genome DNA and diluting for later use; analyzing the sequences of EST, screening the sequence containing a candidate SNP locus, designing a specific primer at the two ends and designing a non-marking probe with the closed 3' end in front of and behind the locus (comprising the locus); performing asymmetric PCR amplification on the scophthalmus maximus group genome DNA by using the primer; hybridizing the amplification product with the non-marking probe with the closed 3' end; and placing the hybrid product on a LightScanner, and detecting and analyzing the melting curve to obtain the genetic polymorphism mapof the scophthalmus maximus. The method is applicable to detection technologies of scophthalmus maximus genetic marking, genealogy authentication, genetic linkage map construction and the like. According to the method which is convenient, quick and accurate, the scophthalmus maximus T170GSNP marked genetic variation map can be obtained quickly; and the genotype of each individual of the scophthalmus maximus can be detected intuitively.
Owner:YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI

SSR molecular marker method for identifying foxtail millet variety and application

The invention discloses an SSR molecular marker method for identifying a foxtail millet variety and application, and belongs to the technical field of plant variety identification. The method comprises the steps that foxtail millet DNA is extracted, a PCR amplification reaction is performed through the foxtail millet DNA and 5 pairs of SSR core primers, and after electrophoresis detection is performed, the foxtail millet variety is identified according to an electrophoresis detection result; the nucleotide sequences of the SSR core primers are shown as SEQ ID NO.1-10. According to the method, the foxtail millet variety can be effectively distinguished, and an important way is supplied to further identification of a large number of the foxtail foxtail millet varieties.
Owner:HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY

Whole-genome 50KSNP chip for apostichopus japonicus breeding and application

The invention discloses a whole-genome 50KSNP chip for apostichopus japonicus breeding and application. The method comprises the following steps: (1) development of the 50KSNP chip in a whole-genome range of apostichopus japonicus: constructing an apostichopus japonicus sample group, performing SNP typing in the whole-genome range, screening 50KSNP markers of the apostichopus japonicus, designing an HD-marker high-density chip and designing development probes to obtain a liquid-phase chip pool of 48K loci; (2) testing the accuracy and the typing effect of the chip, and ensuring the high accuracy and the good typing effect through DNA sample quality detection, HD-Marker chip detection and result analysis. The chip can be applied to genetic background analysis and character association analysis of the whole genome breeding chip of the apostichopus japonicus in different groups of the apostichopus japonicus.
Owner:OCEAN UNIV OF CHINA +1

Molecular marker and screening method of gift strain nile tilapia oreochromis niloticus streptococcus iniae infection resistant family

The invention discloses a molecular marker and a screening method of gift strain nile tilapia oreochromis niloticus streptococcus iniae infection resistant family. The molecular marker is a sequence shown in SEQ ID NO.20; the screening method comprises five steps of streptococcus iniae infection, genome DNA extraction, primer screening, SRAP-PCR (Sequence-Related Amplified Polymorphism-Polymerase Chain Reaction) amplification and sequencing and analyzing, by the method, a parent family with stronger resistance to streptococcus iniae disease can be found more accurately and quickly, after enhanced cultivation, the parent family can be used as the parent for fingerlings propagation. The molecular marker screened out is prepared into a probe for detecting different parent families, the probe can sort out the streptococcus iniae disease resistant parent more simply and accurately, and selection of parent among different families is facilitated. Meanwhile, by using the bred disease-resistant parent as the propagation parent, quality of fingerlings can be improved further, and culture benefit of gift strain nile tilapia oreochromis niloticus can be increased.
Owner:FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI

12C<6+> ion beam radiation type breeding method for isatis tinctoria

The invention relates to a 12C<6+> ion beam radiation type breeding method for an isatis tinctoria. The method comprises following steps of (1) selecting two kinds of parent materials according to a breeding objective, wherein one is a local germplasm with the relatively strong stress resistance, selected from local varieties, and the other is a breeding material selected from Anhui isatis tinctoria germplasm; (2) carrying out reciprocal cross on the two kinds of parent materials, then screening and reserving seeds for planting; (3) soaking the seeds in warm water, and then drying or naturally air drying, so as to obtain dried seeds; (4) soaking the dried full seeds, then air drying water on the surfaces of the seeds, irradiating a sample by a 12C<6+> ion beam, so as to obtain irradiated seeds; (5) planting the irradiated seeds in a field so as to obtain a first-generation group, carefully choosing 200 variation single plants according to the original parent; (6) continuously planting the variation single plants, harvesting, reserving seeds from second-generation single plants, continuously reserving seeds and breeding to obtain third-generations plants and fourth-generation plants; and (7) identifying and testing excellent mutation strains. The method has the high efficiency and realizes the purposes of synchronous improvement of multiple characters such as yield, quality and stress resistance within a short breeding period.
Owner:INST OF MODERN PHYSICS CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products