39 results about "Porcine deltacoronavirus" patented technology

The invention discloses a preparation method of a porcine deltacoronavirus (PDCoV) recombinant N protein. The method comprises the steps that the N gene segment of the PDoV is amplified, subjected toprokaryotic expression and purified in sequence, and the recombinant N protein is obtained. On this basis, the invention further provides a preparation method of a polyclonal antibody of the recombinant N protein. The method comprises the steps that the PDoV recombinant N protein and the Freund's adjuvant are emulsified to immunize animals to obtain polyclonal antibody serum. Through experiments,it is shown that the N gene of the PDCoV is successfully amplified, and the amplified N gene is subjected to prokaryotic expression and purified, the immunogenicity of the recombinant N protein is primarily studied, and a basis is laid for developing a diagnostic kit or preparing the polyclonal antibody.

The invention provides a porcine epizootic diarrhea, transmissible gastroenteritis and porcine deltacoronavirus triple subunit vaccine, which consists of an antigen and a vaccine adjuvant, wherein theantigen includes porcine epizootic diarrhea virus S1 protein which is expressed by an X33-PEDV-S1 strain that preservation number of CGMCC No.14372, transmissible gastroenteritis virus S1 protein which is expressed by an X33-TGEV-S1 strain that preservation number is CGMCC No.14371 and porcine deltacoronavirus S1 protein which is expressed by an X33-PDCoV-S1 strain that preservation number is CGMCC No.14370. The porcine epizootic diarrhea, transmissible gastroenteritis and porcine deltacoronavirus triple subunit vaccine provided by the invention is high in safety and good in immunogenicity, and the triple vaccine, after being applied to immunization, can rapidly generate an antibody and can keep antibody titer at a relatively high level for a long time; the vaccine is long in preservationperiod and low in immunizing dose; the adopted adjuvant is easy to inject; and three major diarrhea-related viral diseases can be prevented and treated by conducting injection once, so that the survival rate of piglets is improved.

The invention belongs to the technical field of animal virology and epizootiology, particularly relates to separation of a porcine deltacoronavirus strain, preparation and application of an inactivated vaccine, and discloses a separating cultivation method of the porcine deltacoronavirus strain, preparation and application of the inactivated vaccine. According to the invention, the separated porcine deltacoronavirus CHN-HN-2014 strain is preserved in China Center for Type Culture Collection with the preservation number of CCTCC NO: V201650. The preserved inactivated vaccine prepared by porcinedeltacoronavirus has good immunogenicity, can induce piglets to generate neutralizing antibody with higher level, and can effectively protect immunized piglets from attack of the porcine deltacoronavirus.

The invention discloses a TaqMan fluorogenic quantitative PCR kit and a detection method for porcine deltacoronavirus. The kit comprises specific primers and a probe, wherein primer sequences are as follow: the upstream primer is 5'-ACGTCGTAAGACCCAGCATC-3' and the downstream primer is 5'-CCCACCTGAAAGTTGCTCTC-3', and a probe sequence is 5'-FAM-GTATGGCTGATCCTCGCATCATGGC-BHQ1-3'. A gene part fragment648bp of the porcine deltacoronavirus is expanded, a lowest detection limit of the TaqMan real-time fluorogenic quantitative PCR disclosed by the invention is 26.6copies/mu L, and the detection results of the TaqMan real-time fluorogenic quantitative PCR to swine transmissible gastroenteritis virus, porcine epidemic diarrhea virus, porcine kobuvirus, porcine reproductive and respiratory syndromevirus as well as foot and mouth disease virus are all feminine. The TaqMan probe real-time fluorogenic quantitative PCR method for detecting the porcine deltacoronavirus (PDCoV) disclosed by the invention has the advantages of strong specificity, high sensitivity and good inter-batch and intra-batch repeatability. When the TaqMan probe real-time fluorogenic quantitative PCR method disclosed by theinvention are used for detecting 194 clinical pig manure samples, a result shows that a PDCoV positive rate is 22.1% and is about one time higher than a 11.9% positive rate of detecting the clinicalpig manure samples by general RT-PCR.

The invention belongs to the field of biotechnology detection and particularly relates to a double-antibody sandwich ELISA antigen detection kit for Porcine deltacoronavirus (PDCoV) N protein. The kitcomprises a monoclonal antibody PDCoV-N-1A2 ELISA plate, positive and negative controls, an HRP labeled detection antibody PDCoV-N-5C5, a sample diluent, a color developing solution and a washing solution, wherein the antibodies PDCoV-N-1A2 and PDCoV-N-5C5 are secreted by hybridoma cell strains PDCoV-N-1A2 and PDCoV-N-1A2, respectively. The kit of the invention can specifically detect PDCoV N protein by the double-antibody sandwich ELSIA method established by using 1A2 as a capture antibody and using hybridization 5C5 (HRP coupled) as a detection antibody, and provides a new detection means for the clinical diagnosis and epidemiological investigation of PDCoV infection.

The invention provides a porcine deltacoronavirus and application thereof. The porcine deltacoronavirus is isolated from pig intestinal tissues, and a porcine deltacoronavirus PDC-SX19 is obtained bypassage and purification, with a preservation number of CGMCC No. 18332. The isolate can realize stable proliferation on the passage cells and produce typical cytopathy. The porcine deltacoronavirus isolate of the invention has an excellent immunogenicity; a vaccine prepared by the isolate can induce piglets to produce a high-level neutralizing antibody; and an ELISA kit prepared by the isolate can better detect the porcine deltacoronavirus antibody in serum.

The invention discloses a multiple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group and kit for rapidly distinguishing PEDV (porcine epidemic diarrhea virus), PDCoV (porcine deltacoronavirus) and PReoV (porcine reovirus), and belongs to the technical field of animal virology and molecular biology. The kit comprises primer sequences as shown in SEQ ID 1-6, Prime STARHR buffer solution, a cDNA template and sterile water. The multiple RT-PCR detection kit of the PEDV, the PDCoV and the PReoV is amplified by multiple RT-PCR, three lesions are similar and serve as primary detection of RNA viruses, total detection time is controlled to be about 2 hours, the detection method is easy to operate, convenient and rapid, and rapid detection can be achieved.

The invention provides a bivalent attenuated vaccine for porcine epidemic diarrhea and porcine deltacoronavirus and a preparation method thereof. By adopting a cell continuous passage method and a cell suspension culture technology, the invention provides the bivalent attenuated vaccine which is high in immune protection rate, good in stability, high in yield, safe and reliable and is used for emergency prevention of inoculated porcine epidemic diarrhea and porcine deltacoronavirus, and an effective means is provided for prevention and control of PEDV and PDCoV.

The invention belongs to the technical field of animal virology, and particularly relates to a method for efficiently separating pig intestinal tract coronavirus. The pig intestinal tract coronavirusis prepared from PEDV (Porcine Epidemic Diarrhea Virus), PDCoV(Porcine Deltacoronavirus) and TGEV (Transmissible Gastroenteritis Virus). According to the method, differential centrifugation is adoptedto remove impurities, PEG(polyethylene glycol) 6000 is used for precipitating and concentrating viruses, impurity contents in a virus sample can be lowered to a maximum degree through the steps of purification of virus by the sucrose gradient centrifugation, and viruses are concentrated. The virus sample prepared with the method is especially suitable for inoculating cells and separating viruses.Compared with the virus sample prepared in the prior art, the method is characterized in that cell toxicity is greatly reduced, a virus separation rate is obviously improved, and the separation rateis improved to be above 40% from 10% of a traditional method.

The invention discloses a primer and a probe for detecting porcine deltacoronavirus, a fluorescent quantitative PCR kit as well as a method and application, wherein a nucleotide sequence of the primeris as follows: an upstream primer: 5'CGCTTAACTCCGCCATCAA 3', and a downstream primer: 5'TGGTGTAACGCAGCCAATAGC 3'; the sequence of the probe is as follows: 5'FAM-CCCGTTGAAAACC-MGB 3'. The invention has the benefits that the detection of the porcine deltacoronavirus can be achieved quickly and accurately by using the kit provided by the invention; the kit provided by the invention has good linear relation in the template range of 3.15*10<1>-3.15*10<8>copies*[mu]L<-1>, and the sensitivity is 100 times that of a conventional PCR; the kit is good in specificity, and has no cross-reactivity with other porcine viruses; a reproducibility test coefficient of variation is less than 1.3%; compared with the conventional PCR method, the method has a higher positive detection rate for clinical samples;in summary, the method is strong in specificity, high in sensitivity and good in reproducibility, and provides a rapid and accurate detection method for laboratory diagnosis and epidemiological investigation of the porcine deltacoronavirus.

The invention discloses a porcine viral diarrhea detection primer combination, a detection kit and application, and relates to the technical field of porcine viral diarrhea detection. The kit comprises a first probe primer pair, a second probe primer pair, a third probe primer pair and a fourth probe primer pair. The detection primer combination and the detection kit can be used for detecting and analyzing porcine epidemic diarrhea, porcine transmissible gastroenteritis, porcine rotavirus and porcine deltacoronavirus in a sample at one time, so that the amplification efficiency of four virus genes is consistent, and the sensitivity of the four virus genes is consistent with that of each single reaction; the method has the characteristics of simplicity, convenience, rapidness, good stability, high detection sensitivity and strong specificity. The detection kit provided by the invention has the advantages of convenience in detection, high accuracy and high detection efficiency, can be applied to daily detection work in pig farms, and provides technical support for clinical diagnosis of four viruses with similar clinical manifestation for porcine viral diarrhea.

This application discloses a five-fold RT-PCR detection method for the pathogen of porcine viral diarrhea disease, in which the five pairs of primers are the detection primers of porcine delta coronavirus (also known as porcine D-coronavirus) and the detection primers of porcine protuberance virus , Porcine epidemic diarrhea virus detection primers, porcine acute diarrhea syndrome coronavirus detection primers, transmissible gastroenteritis virus detection primers. Using the nucleic acid or reverse transcription product of the sample to be tested as a template, use 2×Taq Plus Master Mix to perform PCR amplification using 5 pairs of primers in this application. The patent allows simultaneous detection of up to five viruses that can cause diarrhea in pigs in one PCR reaction tube, and its detection sensitivity reaches an initial template concentration of 1×10 per microliter ³ copies (1×10 ³ copies/μL), and has excellent specificity and repeatability, and can be directly applied to the detection of clinical samples.