44 results about "Ehrlichia" patented technology

The invention provides compositions and methods for the detection and quantification of A. phagocytophilum (formerly known as Ehrlichia equi) antibodies and antibody fragments.

The invention provides peptide compositions and mixtures useful for the detection of antibodies that bind to Ehrlichia antigens. The peptide compositions and mixtures comprise polypeptide sequences based on an immunogenic fragment of the Ehrlichia Outer Membrane Protein 1 (OMP-1) protein. The invention also provides devices, methods, and kits comprising such peptide compositions and mixtures useful for the detection of antibodies that bind to Ehrlichia antigens and the diagnosis of monocytic and / or granulocytic ehrlichiosis.

The invention relates, in part, to nucleic acid constructs, genetically modified host cells and methods employing such constructs and host cells to increase the production of 3-methyl-2-butenol from IPP. Thus, in some aspects, the invention provides a genetically modified host cell transformed with a nucleic acid construct encoding a fusion protein comprising a phosphatase capable of catalyzing the dephosphorylation of dimethylallyl diphosphate (DMAPP) linked to an IPP isomerase capable of converting IPP to DMAPP, wherein the nucleic acid construct is operably linked to a promoter. In some embodiments, the genetically modified host cell 5 further comprises a nucleic acid encoding a reductase that is capable of converting 3-methyl-2-butenol to 3-methyl-butanol. In some embodiments, the reductase is encoded by a nucleic acid construct introduced into the cell. In some embodiments, the IPP isomerase is a Type I isomerase. In some embodiments, the IPP isomerase is a Type II isomerase. In some embodiments, the host cell is selected from a group of taxonimcal classes consisting of 20 Escherichia, Enterobacter, Azotobacter, Erwinia, Bacillus, Pseudomonas, Klebsiella, Proteus, Salmonella, Serratia, Shigella, Rhizobia, Vitreoscilla, Synechococcus, Synechocystis, and Paracoccus taxonomical classes. In some embodiments, the host cell is an Escherichia coli cell. In some embodiments, the host cell is a fungal cell, such as a yeast cell. In some embodiments, the yeast cell is a Saccharomyces sp. cell. In some embodiments, the host cell is an algal, insect or mammalian cell line. In some embodiments, the phosphatase is nudB from E. coli. In some embodiments, the IPP isomerase is encoded by an idi gene from E. coli or idil gene from Saccharomyces cerevisiae.

The invention discloses a fluorescent quantitation PCR detection of Ehrlichia bacterium and a typing primer, a probe and a kit. The sequence of the primer is shown in SEQ ID No. 1 and 2; the probe is shown in SEQ ID No. 3 and 4. The primer and the probe are adopted to carry out the PCR amplification for the bacterium to be detected and amplify 210bp band, and the fluorescent detection enhanced in 640 nanometers wavelength is positive samples of Ehrlichia bacterium; and then the Ehrlichia bacterium are typed according to the melting temperature. The invention has obvious technical advantages, high specificity and high sensitiveness, can conveniently detect all kinds of Ehrlichia bacteria, can be used for diagnosing and treating human and various animals (cattle, dogs and sheep) and Ehrlichia chafeensis diseases, and has good economic benefits.

The invention discloses a gene recombinant vaccine for preventing enterovirus 71 (EV71) infection and a preparation method thereof. The inflection comprises multiple diseases related with the nervous system such as hand-foot-and-mouth disease, paralytic diseases of sterile meningitis, cephalitis and poliomyelitis and the like. Escherichia coli labile enterotoxin B subunit (LTB) is used as an immunological enhancement adjuvant, two fragments of linear neutralizing epitope SP55 and SP70 in EV71 virus coat protein VP1 are used as antigens, prokaryotic expression plasmids of LTB-SP55-SP70 fusion genes are constructed by using gene engineering technology, the plasmids are expressed in escherichia coli, and a recombinant expression product is purified for preparing the EV71 virus gene engineering vaccine.

The invention provides a recomposed large intestine Escherichia coli expressing adenosine methionine synthetase with CGMCC No. 2299 and the composition method of the recomposed large intestine Escherichia coli. The invention further provides a recomposed expression carrier pMETK of adenosine methionine synthetase. In the recomposed large intestine Escherichia coli expressing adenosine methionine synthetase with CGMCC No. 2299, the expression quantity of the adenosine methionine synthetase accounts for 31.36 percent of soluble albumen of the strain, the activity of the adenosine methionine synthetase expressed is as high as 7.38U / ml, far higher than that of wild type strains.

The invention discloses an amplification primer for detecting food-borne pathogenic microorganisms and a liquid chip kit. The kit comprises an amplification primer pair designed for microorganism genes to be detected; and a forward primer and a reverse primer of microorganisms to be detected comprise at least one pair of SEQ ID NO. 1 and SEQ ID NO. 2 for enterobacter sakazakii, SEQ ID NO. 3 and SEQ ID NO. 4 for monocyte listeria monocytogenes, SEQ ID NO. 5 and SEQ ID NO. 6 for escherichia coli O157, SEQ ID NO. 7 and SEQ ID NO. 8 for staphylococcus aureus, SEQ ID NO. 9 and SEQ ID NO. 10 for shigella, SEQ ID NO. 11 and SEQ ID NO. 12 for salmonella, and SEQ ID NO. 13 and SEQ ID NO. 14 for vibrio parahaemolyticus, and magnetic beads coated with Anti-tag sequences. The amplification primer designed by the invention has excellent specificity, and can accurately distinguish and specifically amplify gene segments corresponding to various target detection pathogenic microorganisms. In addition, the sensibility of the detecting kit designed by the invention is greatly improved. An experiment result shows that sensibility of detection of seven food-borne pathogenic microorganisms can reach 10 CFU / mL.

The present invention discloses construction and applications of nicotinamide adenine dinucleotide (NAD) auxotrophic Escherichia microbe, wherein NAD transporter protein is introduced to the Escherichia microbe, an intracellular NAD biosynthesis pathway is blocked, and the Escherichia engineered bacteria growing dependent on exogenous pyridine nucleotide coenzyme is constructed. The NAD auxotrophic Escherichia can be used in the field of bio-technology, and can be provided for screening inhibition drugs for pyridine nucleotide coenzyme metabolism, improving oxidation reduction biotransformation efficiency, and establishing non-antibiotic screening platforms for gene cloning and protein heterogenesis expression.

Provided are an Escherichia species microorganism and Corynebacterium species microorganism that are transformed with a foreign NADP dependent glyceraldehydes-3-phosphate dehydrogenase gene and have the ability to produce L-lysine and a method of producing L-lysine using the microorganisms.

A process for treating a patient with leukemia or an aplastic anemia having cells with inclusions that stain with anti-E. canis antibodies or antibodies to other Ehrlichia or Anaplasma is disclosed. That process comprises administering to the patient (i) an antibacterial amount of a rifamycin, (ii) an antibacterial amount of a quinolone, or a mixture of (i) and (ii).

Escherichia coli for detecting lead is disclosed. Escherichia coli for detecting lead is disclosed. The invention provides a construction method of an escherichia coli engineered strain for detecting heavy metal lead and establishment of a method for detecting lead in a water body. The gene engineering strain is PpbrA-pbrR-PpbrA::DsRed-express2 / E.coli delta zntR delta zntA, named as E.coli WMC-008p CGMCC No.9748, wherein zntA and zntR genes undergo deletion mutation so as to be inactivated, and a pbr operon originated from a Cupriavidus metallidurans CH34 strain is knocked-in to express the red fluorescence protein DsRed-express2. In comparison with a reporter plasmid-containing E. coli reporter strain, the engineering strain provided by the invention has advantages of simple operation, low fluorescence background value, stable signal and the like. The engineering strain can reflect bio-availability of lead in a water body and provides a basis for objective evaluation of bio-toxicity effects of lead in a water body.

The present invention relates, in general, to granulocytic ehrlichia (GE) proteins. In particular, the present invention relates to nucleic acid molecules coding for GE S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins; purified GE S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins and polypeptides; recombinant nucleic acid molecules; cells containing the recombinant nucleic acid molecules; antibodies having binding affinity specifically to GE S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins and polypeptides; hybridomas containing the antibodies; nucleic acid probes for the detection of nucleic acids encoding GE S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins; a method of detecting nucleic acids encoding GE S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins or polypeptides in a sample; kits containing nucleic acid probes or antibodies; bioassays using the nucleic acid sequence, protein or antibodies of this invention to diagnose, assess, or prognose a mammal afflicted with ehrlichiosis; therapeutic uses, specifically vaccines comprising S2, S7, S22, S23, C6.1, C6.2, S11, E8, E46#1, and E46#2 proteins or polypeptides or nucleic acids; and methods of preventing or inhibiting ehrlichiosis in an animal.

The present invention provide a composition of non-toxic low-cost ingredients that effectively kill pathologic bacteria and methods for use of the composition. The present invention comprises novel compositions and methods for controlling enteric pathogens and spoilage organisms such as Salmonella, Escherichia, Campylobacter, Listeria, Pseudomonas and Enterobacteracae on the surface of meat products and food preparation surfaces.

The invention belongs to the technical field of biology. The invention provides poultry pathogenic escherichia coli strain, the strain is Escherichia coli, and the preservation number is CGMCC 10602. The invention further provides inactivated vaccine for the poultry pathogenic escherichia coli, and the inactivated vaccine for the poultry pathogenic escherichia coli is O 78 serotype poultry escherichia coli inactivate whole bacterial and adjuvant. The immune protective rates of the inactivated vaccine for the poultry pathogenic escherichia coli to the serotype O78 poultry pathogenic escherichia coli virulent strain challenge all reach over 90 percents. The inactivated vaccine for the poultry pathogenic escherichia coli has great immune protective effect on the O 78 serotype poultry escherichia coli strain infection.

The invention relates to a microorganism method for detecting metallic-arsenic-like in water, in particular to an escherichia coli report bacterial strain culturing method improved through genetic engineering, and an escherichia coli culturing method for detecting arsenic in water. The detection bacterial strain is obtained by adopting a Red recombination system to knockout arsenic resistant arsB genes of wild type escherichia coli MC4100, and then adopting the gene knockin technology to substitute pars-arsR-gfpmut2 report genes to the positions of araB coding genes. The biological detection bacterial strain is named as E.coli WMC-011p. The lowest arsenic detection range meets the Integrated Wastewater Discharge Standard of GB8978-1996. The bacterial strain overcomes the shortcomings of high fluorescence background value, unstable detection signals, inaccurate results and the like of a biological detection bacterial strain based on a plasmid vector, and has the advantages of high specificity, high sensitivity, low cost and the like.

The present invention provides an isolated and purified heat shock protein 60 (Hsp60) peptide having the amino acid sequence of SEQ ID NO:2. The instant invention is also directed to a vaccine against Ehrlichia comprising a peptide homologous to the amino acid sequence of SEQ ID NO:2. The instant invention is also directed to an antibody directed against a peptide homologous to the amino acid sequence of SEQ ID NO:2. The instant invention is also directed to a method of determining whether a subject is infected with Ehrlichia, comprising the steps of: contacting a sample from a subject with the antibody described herein; and detecting a resulting antibody reaction, wherein a positive reaction indicates the subject is infected with Ehrlichia.

Provided are mutant strains derived from Escherichia sp. GPU1114 (Accession No. KCCM-10536), having cumulative inactivation of deoD, aphA, appA, and hprt genes, and methods of using the same.

The invention relates to the technical field of molecular biomedicine, in particular to a PCR (Polymerase Chain Reaction) detection kit for cat and / or dog pathogens, a detection method and application. The kit is used for detecting canine distemper virus, canine influenza A virus, canine parainfluenza virus, canine parvovirus, canine coronavirus, canine rotavirus, canine babesia, canine ascaris, canine Ehrlichia, canine brucella, rabies virus, borrelia burgdorferi, reference gene ACTB, feline herpes virus, feline calicivirus and feline parvovirus. The kit comprises primers and probes of feline coronavirus, feline immunodeficiency virus, feline leukemia virus, feline mycoplasma, feline mycoplasma, feline chlamydia, giardia, toxoplasma, bartonella and reference gene GAPDH, collected DNA and RNA are added into the kit, a real-time fluorescence PCR instrument is adopted for PCR reaction, FAM, HEX, ROX and CY5 fluorescence signals are collected in each cycle, analysis of related pathogens is carried out, and the kit can be used for detecting the feline and the canine. Compared with a traditional detection method, the method has the advantages of higher specificity and higher sensitivity.

Tools and methods for detecting the presence of E. canis and E. chaffeensis in a sample obtained from an animal are provided. The methods employ a polymerase chain reaction and primer sets that are based on the p30 gene of E. canis and the p28 gene of E. chaffeensis. The present invention also relates to the p30 and the p28 primer sets. Each p30 primer set comprises a first primer and the second primer, both of which are from 15 to 35 nucleotides in length. The first p30 primer comprises a sequence which is complementary to a consecutive sequence, within the following sequence: CCA AGTGTCTCAC ATTTTGGTAG CTTCTCAGCT AAAGAAGAAA GCAAATCAAC TGTTGGAGTTTTTGGATTAA AACATGATTG GGATGGAAGT CCAATACTTA AGAATAAACA CGCTGACTTTACTGTTCCAA AC. SEQ ID NO.1. The second p30 primer comprises a sequence which is complementary to the inverse complement of a consecutive sequence contained within the following sequence: GTTACT CAATGGGTGG CCCAAGAATA GAATTCGAAA TATCTTATGA AGCATTCGAC GTAAAAAGTC CTAATATCAA TTATCAAAAT GACGCGCACA GGTACTGCGC TCTATCTCAT CACACATCGG CAGCCAT, SEQ ID NO.2. The first p28 comprises a sequence which is complementary to a consecutive sequenc, within the following sequence: A GTTTTCATAA CAAGTGCATT GATATCACTA ATATCTTCTC TACCTGGAGT ATCATTTTCC GACCCAACAG GTAGTGGTAT TAACGG, SEQ ID NO. 3. The second p28 primercomprises a sequence which is complementary to the inverse complement of a consecutive sequencewithin one of the following two sequences: CAT TTCTAGGTTT TGCAGGAGCT ATTGGCTACT CAATGGATGG TCCAAGAATA GAGCTTGAAG TATCTTATGA, SEQ ID NO. 4, or C AAGGAAAGTT AGGTTTAAGC TACTCTATAA GCCCAGA, SEQ ID NO. 5.