31 results about "Ehrlichia canis" patented technology

The invention provides compositions and methods for the detection and quantification of Ehrlichia chaffeensis or Ehrlichia canis, Ehrlichia chaffeensis or Ehrlichia canis antibodies, antibody fragments, and polypeptides.

Sequences encoding two immunoreactive glycoproteins were cloned from Ehrlichia canis (p153 gene) and Ehrlichia chaffeensis (p156 gene). These two glycoproteins are species-specific immunoreactive orthologs that are useful as subunit vaccines and for serologic and molecular diagnostics for E. canis and E. chaffeensis.

The invention provides methods and compositions for the detection of Ehrlichia canis and Ehrlichia chaffeensis antibodies and antibody fragments.

The present invention is directed to the cloning, sequencing and expression of homologous immunoreactive 28-kDa protein genes, p28-1, -2, -3, -5, -6, -7, -9, from a polymorphic multiple gene family of Ehrlichia canis. Further disclosed is a multigene locus encoding all nine homologous 28-kDa protein genes of Ehrlichia canis. Recombinant Ehrlichia canis 28-kDa proteins react with convalescent phase antiserum from an E. canis-infected dog, and may be useful in the development of vaccines and serodiagnostics that are particularly effective for disease prevention and serodiagnosis.

The present invention relates to an attenuated strain of Ehrlichia canis and a vaccine comprising said attenuated strain for protection of mammals against ehrlichiosis. The invention further relates to methods of preventing ehrlichiosis and of attenuating the pathogenicity Ehrlichia canis.

The present invention relates to a method of culturing bacterial organisms belonging to the family Anaplasmataceae in mammalian embryonic or fetal cells. In particular, the present invention is directed to growth of bacterial organisms belonging to the family Anaplasmataceae including organisms belonging to the Anaplasma, Ehrlichia and Neorickettsia genera. The bacterial organisms may be cultured in mammalian embryonic or fetal host cells including feline embryonic host cells. Bacterial material cultured according to the methods described herein may be used as the basis for vaccines against diseases associated with the Anaplasmataceae bacteria, or as the basis for diagnostic applications useful for diagnosing diseases associated with the Anaplasmataceae bacteria.

This invention provides the sequence of 5,299 nucleotides from the E. canis genome. There are four proteins, ProA, ProB, MmpA, and a cytochrome oxidase homolog, as well as a partial lipoprotein signal peptidase homolog at the carboxy terminus, coded for in this cloned fragment. The antigenic properties of these proteins allow them to be used to create a vaccine. An embodiment of this invention includes the creation of a DNA vaccine, a recombinant vaccine, and a T cell epitope vaccine. Another embodiment of this invention includes the use of serological diagnosis techniques.

The present invention relates to a method of culturing bacterial organisms belonging to the family Anaplasmataceae in mammalian embryonic or fetal cells. In particular, the present invention is directed to growth of bacterial organisms belonging to the family Anaplasmataceae including organisms belonging to the Anaplasma, Ehrlichia and Neorickettsia genera. The bacterial organisms may be cultured in mammalian embryonic or fetal host cells including feline embryonic host cells. Bacterial material cultured according to the methods described herein may be used as the basis for vaccines against diseases associated with the Anaplasmataceae bacteria, or as the basis for diagnostic applications useful for diagnosing diseases associated with the Anaplasmataceae bacteria.

Tools and methods for detecting the presence of E. canis and E. chaffeensis in a sample obtained from an animal are provided. The methods employ a polymerase chain reaction and primer sets that are based on the p30 gene of E. canis and the p28 gene of E. chaffeensis. The present invention also relates to the p30 and the p28 primer sets. Each p30 primer set comprises a first primer and the second primer, both of which are from 15 to 35 nucleotides in length. The first p30 primer comprises a sequence which is complementary to a consecutive sequence, within the following sequence: CCA AGTGTCTCAC ATTTTGGTAG CTTCTCAGCT AAAGAAGAAA GCAAATCAAC TGTTGGAGTTTTTGGATTAA AACATGATTG GGATGGAAGT CCAATACTTA AGAATAAACA CGCTGACTTTACTGTTCCAA AC. SEQ ID NO.1. The second p30 primer comprises a sequence which is complementary to the inverse complement of a consecutive sequence contained within the following sequence: GTTACT CAATGGGTGG CCCAAGAATA GAATTCGAAA TATCTTATGA AGCATTCGAC GTAAAAAGTC CTAATATCAA TTATCAAAAT GACGCGCACA GGTACTGCGC TCTATCTCAT CACACATCGG CAGCCAT, SEQ ID NO.2. The first p28 comprises a sequence which is complementary to a consecutive sequenc, within the following sequence: A GTTTTCATAA CAAGTGCATT GATATCACTA ATATCTTCTC TACCTGGAGT ATCATTTTCC GACCCAACAG GTAGTGGTAT TAACGG, SEQ ID NO. 3. The second p28 primercomprises a sequence which is complementary to the inverse complement of a consecutive sequencewithin one of the following two sequences: CAT TTCTAGGTTT TGCAGGAGCT ATTGGCTACT CAATGGATGG TCCAAGAATA GAGCTTGAAG TATCTTATGA, SEQ ID NO. 4, or C AAGGAAAGTT AGGTTTAAGC TACTCTATAA GCCCAGA, SEQ ID NO. 5.

Provided herein are chimeric polypeptides that may be used, e.g., for the diagnosis of or vaccination against Ehrlichia chaffeensis and / or Ehrlichia canis.

Novel genes encoding homologous immunoreactive thio-disulfide oxidoreductases, or disulfide bond formation (Dsb) proteins from Ehrlichia chaffeensis and Ehrlichia canis are disclosed. While the E. chaffeensis and E. canis Dsb proteins are at most only 31% or less homologous to other known Dsb proteins, the Ehrlichia Dsbs contain a cysteine active site, Cys-Gly-Tyr-Cys, similar to those in known Dsb proteins. As predicted by 15-amino acid identical N-terminal signal peptides, the proteins are primarily localized in the periplasm of E. chaffeensis and E. canis, possibly playing a role in antigenicity and pathogenesis. The present invention provides the nucleotide and amino acid sequences and expression vectors for the E. chaffeensis and E. canis dsb genes, antisera directed against the proteins, and kits to determine whether an individual or animal is infected with a given species of Ehrlichia.

Provided herein are chimeric polypeptides that may be used, e.g., for the diagnosis of or vaccination against Ehrlichia chaffeensis and / or Ehrlichia canis.

Vaccine and / or immunogenic compositions that comprise an effective immunizing amount of an antigen from E. canis are described. In addition, methods of immunizing a subject against E. canis by providing the vaccine and / or immunogenic compositions are also disclosed.

The present invention is directed to the cloning, sequencing and expression of homologous immunoreactive 28-kDa protein genes, p28-1, -2, -3, -5, -6, -7, -9, from a polymorphic multiple gene family of Ehrlichia canis. Further disclosed is a multigene locus encoding all nine homologous 28-kDa protein genes of Ehrlichia canis. Recombinant Ehrlichia canis 28-kDa proteins react with convalescent phase antiserum from an E. canis-infected dog, and may be useful in the development of vaccines and serodiagnostics that are particularly effective for disease prevention and serodiagnosis.

Vaccine and / or immunogenic compositions that comprise an effective immunizing amount of an E. canis bacterin are described. In addition, methods of immunizing a subject against E. canis by providing the vaccine and / or immunogenic compositions are also disclosed.

Primer pair, kit and method for detecting Ehrlichia canis are disclosed. The primer pair includes a forward primer and a reverse primer, and the kit includes the primer pair and a probe. The forward primer has a sequence of SEQ ID NO: 1, the reverse primer has a sequence of SEQ ID NO: 2, and the probe has a sequence of SEQ ID NO: 3.

The present invention is directed to the cloning, sequencing, expression, and characterization of an immunoreactive ferric binding protein (Fbp) (38-kDa) protein of Ehrlichia canis encoded by a polynucleotide therefor. In particular embodiments, the protein is employed in an immunogenic composition, such as a vaccine. Methods to induce an immune reaction in an individual with compositions of the invention are provided.