33 results about "Calcium dependent" patented technology

The application provides a method of treating fibrous textile goods comprising treating the fibrous textile goods with an enzyme. This enzyme can be used to covalently link one or more active functional compounds to the fibres and / or to trap one or more acitve functional compound within an inter-fibre matrix and / or within an intra-fibre matrix formed by the action of the enzyme. Preferably, the enzyme is a traglutaminase, especially a calcium-dependent transglutaminase. The enzyme may be used to add primary-amine containing active agents to the textile goods and also for the addition of proteins or peptides that have functional groups linked to them.

Compositions and methods for the treatment of toxoplasmosis, caused by the infectious eukaryotic parasite Toxoplasma gondii (T. gondii) and for the treatment of cryptosporidiosis, caused by the infectious eukaryotic parasites Cryptosporidium parvum (C. parvum) and Cryptosporidium hominus (C. hominus) are described. In particular, the present disclosure is directed to compositions and methods for inhibiting either T. gondii calcium dependent protein kinases (TgCDPKs) or C. parvum and C. hominus calcium dependent protein kinases (CpCDPKs) using pyrazolopyrimidine and / or imidazo[1,5-a]pyrazine inhibitors, of the formula,wherein the variables X, Y, Z, L, R1, and R3 are defined herein.

The invention aims to provide a novel alkaline protease having peculiar properties such as high alkali activity, resistance to surfactants and calcium-dependent thermostability and exhibiting excellent performance in highly alkaline detergents, and a gene coding for the amino acid sequence thereof. There is provided an alkaline protease with such properties that an active pH range is from 5 to 13, an optimum pH is approximately 12.6, an optimum temperature is 70° C., no activity drop by heating is observed up to 65° C. at pH 10 and the optimum temperature and the thermostability are not affected by Ca2+ ions. Specifically, there is provided, for example, an alkaline protease having an amino acid sequence constituting a mature enzyme as represented by SEQ ID NO: 3 or an amino acid sequence resulting from deletion, substitution, situs inversus arrangement, addition or insertion of a part of amino acids thereof, or derived from Alkaliphillus transvaalensis. The protease cleaves 26 peptide bonds among 29 peptide bonds of acidic insulin B-chain.

The present invention relates to a microorganism belonging to the group of lactic acid bacteria capable of specifically binding to Streptococcus mutans, wherein the specific binding is (i) resistant to heat treatment; (ii) resistant to protease treatment; (iii) calcium-dependent; (iv) formed within a pH range between 4.5 and 8.5; and / or (v) formed in the presence of saliva. The present invention is also relates to an analog or fragment of the microorganism which is thermally inactivated or lyophilized, wherein the analog or fragment retains the capability of specifically binding to Streptococcus mutans. The invention further encompasses compositions and additives for food, feed or drinks comprising the microorganism or an analog or fragment thereof. Also provided is uses of the microorganism or an analog or fragment thereof for the preparation of an anticariogenic or pharmaceutical composition or anticariogenic food or feedstuff as well as methods for producing the compositions or food or feedstuff.

Disclosed are the novel glycolipoprotein gintonin isolated and identified from ginseng, a method for preparing the same, and uses thereof. Gintonin causes a transient increase in intracellular free Ca2+ level, which in turn activates endogenous Ca2+-activated chloride channel to elevate intracellular calcium levels. Therefore, the novel glycolipoproteins are useful in the therapy and prophylaxis of calcium deficiency-associated diseases as well as effectively inducing calcium-dependent physiological activities, including adaptogenic activity, immunostimulatory activity, aphrodisiac activity, neuroprotection and neuroactivation, angiogenesis, and antidiabetic activity.

The present disclosure is directed to compositions and methods for inhibiting either Toxoplasma gondii (T. gondii) calcium dependent protein kinases (TgCDPKs) or Cryptosporidium parvum (C. parvum) and Cryptosporidium hominus (C. hominus) calcium dependent protein kinases (CpCDPKs) using pyrazolopyrimidine and / or imidazo[1,5-α]pyrazine inhibitors, of the Formula (I), wherein the variables X, Y, Z, R1, and R3 are defined herein.

Disclosed are the novel glycolipoprotein gintonin isolated and identified from ginseng, a method for preparing the same, and uses thereof. Gintonin causes a transient increase in intracellular free Ca2+ level, which in turn activates endogenous Ca2+-activated chloride channel to elevate intracellular calcium levels. Therefore, the novel glycolipoproteins are useful in the therapy and prophylaxis of calcium deficiency-associated diseases as well as effectively inducing calcium-dependent physiological activities, including adaptogenic activity, immunostimulatory activity, aphrodisiac activity, neuroprotection and neuroactivation, angiogenesis, and antidiabetic activity.

The invention discloses an eimeria tenella gene. The nucleotide sequence of the gene coded calcium-dependent protein kinase comprises a DNA sequence for coding an SEQ ID NO.1 amino acid sequence or a DNA sequence for coding an amino acid sequence with calcium-dependent protein kinase activity obtained by deleting, adding, inserting or replacing one or a plurality of amino acids in the SEQ ID NO.1amino acid sequence. The invention also discloses a protein coded by the gene. The eimeria tenella gene is a new gene highly expressed in a sporozoite phase of the eimeria tenella, and is related to the invasion of a to a host cell. The gene has high application value in developing new vaccines or new medicines for inhibiting the invasion of the sporozoite to the host cell and blocking the life cycle of the eimeria tenella.

The present invention provides methods for determining the structure and / or function of one or more domains of a cation-dependent (and preferably calcium-dependent) polypeptide (particularly a calcium-dependent enzyme, which may be a protease such as calpain) in the presence of one or more cations. The invention further provides methods for identifying a ligand having the ability to bind to one or more ligand-binding domains (LBDs) of a cation-dependent (and preferably calcium-dependent) polypeptide, and ligands identified by these methods. The invention also provides methods of treating or preventing physical disorders in animals using these ligands.

The invention provides application of a novel skeleton compound in preparing drug for preventing and treating parasitic infection disease. The novel skeleton compound can be used as calcium-dependent protein kinase. The invention discloses an isoindole-1, 3-diketone compound which has effect of inhibiting activity of the calcium-dependent protein kinase, can be used for preparing the drug for preventing or / and treating protozoal infectious disease and has potential application prospect in acute and chronic parasitic disease. Comparison tests show that the isoindole-1, 3-diketone compound has obvious higher activity in inhibiting CDPK1 than a pyrazolopyrimidine compound NM-PP1.

Novel human polunucleotide and polypeptide sequences are disclosed that can be used in therapeuutic, diagnostic, and pharmacogenomic applications.

Phospholipase A2 (PLA2) forins are expressed in spinal cord whose inhibition induces a potent antihyperalgesia. PLA2 inhibitor compounds are provided that include a common motif consisting of a 2-oxoamide with a hydrocarbon tail and a four carbon tether. The compounds block Group IVA calcium dependent PLA2 (cPLA2) and / or Group VIA calcium independent PLA2 (iPLA2) and / or Group V secreted PLA2 (sPLA2).

A recombinant conglutinin which contains a collagen region consisting of six amino acids containing two amino acid sequences Gly-Xaa-Xaa (SEQ ID NO:3, wherein Xaa stands for a protein-constituting amino acid), the neck region of natural conglutinin and the sugar chain recognition region of natural conglutinin, has an antiviral activity (virus neutralizing activity), and is expected to be applicable to drugs; and a process for detecting anti-influenza A virus activity of a mannose-binding protein (MBP) or a human mannose-binding protein (hMBP) involving the step of treating influenza A virus-infected cells with the MBP or hMBP and measuring the level of the suppression of the budding of the virus in the virus-infected cells. An MBP and an hMBP having an anti-influenza A virus activity are disclosed.

The present invention is based on two important experimental observations: The first observation is that increased extracellular concentrations of ionized calcium are found in erosive arthritis and stimulate monocytic IL-1β release via the CaSR and GPRC6A. Simultaneous stimulation of monocytes with calcium ions and selected TLR ligands results in a 20-fold increased IL1β response compared to lipopolysaccharide (LPS) alone. During the crosstalk between GPCR and TLR signaling, phospholipase C is activated, which triggers calcium dependent potassium channels, resulting in potassium efflux, caspase-1 activation and IL-1β release. The amplification of IL1β secretion at sites of locally increased calcium ion concentrations aggravates rheumatoid arthritis. The second important observation is that both CaSR and GPRC6A, are highly expressed in the synovial membrane of patients with rheumatoid arthritis, but expression of GPRC6A, but not of CaSR, is lower in patients with osteoarthritis (s. FIG. 1). The latter is generally not accompanied by inflammation. Thus, expression of GPRC6A appears to be upregulated in chronic inflammatory situations. Based on these experimental observations the invention provides a method and compositions for the identification of agents that have a potential effect against chronic inflammatory conditions, in particular erosive arthritis and atherosclerosis.

The invention provides a kit for adult AML (acute myeloid leukemia) risk stratification and clinical prognosis evaluation and an application of CPNE3, namely a gene chip and the kit for conducting risk stratification or clinical prognosis evaluation on patients with adult AML, wherein primer pairs of calcium-dependent membrane combined proteins copine III genes are used, and the sequences of one of the primer pairs are shown as agactcccacgaaactcagg (SEQ ID NO:2) and ctgtgcgctcaacctcatac (SEQ ID NO:3) or complementary sequences thereof, and the primer pairs are used for detecting the expression level of calcium-dependent membrane combined proteins in adult AML cells or tissues.

Cystic fibrosis is developed through mutation of Cystic Fibrosis Transmembrane conductance Regulator (CFTR), which is one type of chloride channel. An object of the present invention is to provide compounds effective in the treatment of cystic fibrosis that open a chloride channel different from CFTR, which is the cause of the disease, and do not depend on CFTR.Compounds of the present invention are compounds or pharmaceutically acceptable salts thereof that open calcium dependent chloride channels (CaCCs) via G-protein coupled receptor 39 (GPR39) agonism to have strong chloride ion-secretory action, and are represented by the following general formula (I):General formula (I):wherein,X represents a carboxyl group or a tetrazolyl group;Q represents a C1-C3 alkylene group, an oxygen atom, a sulfur atom, etc.;G represents a phenyl group where the phenyl group may have 1 to 3 substituents independently selected from the group consisting of a halogen atom, a cyano group, a C1-C6 alkyl group, etc.;R1 represents a C1-C6 alkyl group, etc.;R2 represents a C1-C6 alkyl group that may have 1 to 3 substituents independently selected from the following group A, or a group selected from the following group B:Group A: a phenyl group and a pyridyl group, wherein the phenyl group and the pyridyl group may have 1 to 3 substituents independently selected from the following group D;Group B: —OH, —O-M, —SH, —S-M, —NH2, —NH-M, and —N-M2, wherein M is a C1-C6 alkyl group that may have 1 or 2 substituents independently selected from the following group C, or a C3-C6 cycloalkyl group that may have 1 or 2 substituents independently selected from the following group C;Group C: a halogen atom, a cyano group, a phenyl group, a pyridyl group, etc., wherein the phenyl group and the pyridyl group may have 1 to 3 substituents independently selected from the following group D; andGroup D: a halogen atom, a cyano group, a C1-C6 alkyl group, etc.