Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

84 results about "Species detection" patented technology

Methods and apparatus for molecular species detection, inspection and classification using ultraviolet to near infrared Enhanced Photoemission Spectroscopy

The invention relates generally to the field of substance and material detection, inspection, and classification at wavelengths between approximately 200 nm and approximately 1800 nm. In particular, a handheld Enhanced Photoemission Spectroscopy (“EPS”) detection system with a high degree of specificity and accuracy, capable of use at small and substantial standoff distances (e.g., greater than 12 inches) is utilized to identify specific substances (e.g., controlled substances, illegal drugs and explosives, and other substances of which trace detection would be of benefit) and mixtures thereof in order to provide information to officials for identification purposes and assists in determinations related to the legality, hazardous nature and / or disposition decision of such substance(s).
Owner:CDEX

Gas detector for atmospheric species detection

A gas detector includes a receiver configured to receive light from a light source through gas, the light source having a bandwidth on the order of an absorption linewidth of the gas, the receiver including at least a first etalon having a transmission bandwidth on the order of the absorption linewidth of the gas, the transmission bandwidth of the first etalon being substantially smaller than the bandwidth of the light source. The gas detector further includes a first detector for detecting light transmitted through the first etalon, a second detector for detecting light reflected from the first etalon, and a processor that determines the quantity of gas based on the detected transmitted and reflected light. The gas detector can further include a second etalon with a transmission bandwidth approximately equal and adjacent to the transmission bandwidth of the first etalon. Alternatively, the gas detector can include a beam separator that separates the light from the light source into a first beam and a second beam, with a small deflection angle between the first beam and the second beam, thereby modifying the effective thickness of a single optical element for each beam and forming the first and second etalon in the optical element.
Owner:MASSACHUSETTS INST OF TECH

Brown tide algae species detection method and kit

The invention relates to a brown tide algae species detection method which comprises the following steps: 1) designing and synthesizing specific primers AanF and AanR and an Aan probe, wherein the sequence of the AanF is AAAGCTCGTAGTTGGATTCCTGG; the sequence of the AanR is GTGTTCAACGCACGCTTACG; the sequence of the Aan probe is CTTGCGATGGTCTATCCT; 2) selecting a standard algal strain and constructing a recombinant plasmid standard; 3) constructing a standard curve; 4) verifying the specificities of the primers AanF and AanR and the Aan probe; 5) performing sample detection and result analysis. The detection method provided by the invention can be used for qualitative and quantitative detection of a brown tide algae species and has the advantages of high sensitivity, good reproducibility, continuous measurement, good convenience and high simplicity in operation, high easiness in control, short analysis time and the like.
Owner:CHINESE RES ACAD OF ENVIRONMENTAL SCI

Environmental DNA macro bar code method for researching macrobenthic animal community structure

The invention discloses an environmental DNA macro bar code method for researching a macrobenthic animal community structure. One technical scheme to be protected by the invention is the application of the primer pair in detecting the community structure of the macrobenthos in the water area to be detected. The primer pair is named as COI and is composed of a primer 1 and a primer 2, and the primer 1 and the primer 2 can be a sequence 1 and a sequence 2 in a sequence table. Compared with a traditional method, the COI primer provided by the invention is used for amplifying an environmental DNAsample of a to-be-detected water area, and sequencing and annotation analysis are carried out to obtain more obvious species, especially benthonic animal groups which are easy to escape, small in sizeand partial in life history in water; and the method can supplement benthonic animal abundance data which are easy to ignore, difficult to find and small in size in a traditional investigation method, effectively improves the identification level, species detection rate and abundance evaluation accuracy of the large benthonic animals, and is an effective and reliable new method for investigatingthe community structure of the large benthonic animals.
Owner:RES CENT FOR ECO ENVIRONMENTAL SCI THE CHINESE ACAD OF SCI

Internet-based microbial limit inspection system and method

The invention belongs to the technical field of microbial limit inspection. The invention discloses an internet-based microbial limit inspection system and method. The internet-based microbial limit inspection system comprises an environment cleanliness detection module, a microbial species detection module, a main control module, a network communication module, a microbial function analysis module, a safety evaluation module and a display module. Through the microbial function analysis module, the procedure of analyzing microbial population functions is simplified, and the time is saved; according to the method for analyzing the microbial population function by utilizing the metagenome data, the splicing and prediction processes of sequencing reads are removed, and the function annotation of genes does not need to be carried out by comparing with a conventional single-function database, so that the data analysis time is greatly saved, and the running speed of the whole sequencing data analysis process is increased; and meanwhile, the microorganism safety level can be accurately evaluated through the safety evaluation module.
Owner:JIANGSU SUPERVISION & INSPECTION INST FOR PROD QUALITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products