35results about How to "Identification achieved" patented technology

The invention discloses a molecular identification method for a DNA bar code of lumbricus and a CO I sequence thereof. The method comprises the following steps: amplifying a sample CO I gene through polymerase chain reaction (PCR); verifying the PCR product through agarose gel and then sending to a biological sequencing company for sequencing; manually correcting and splicing sequence for the sequencing result; comparing with a public sequence; and if the homology of the gene sequence SEQ ID NO.1-NO.4 is above 99%, confirming a to-be-detected tissue as a source of pheretima aspergillum or Shanghai lumbricus. According to the invention, a reliable DNA molecular identification technique is adopted; the morphological identification for lumbricus varieties is not required; the lumbricus varieties and non-drug lumbricus varieties specified in Chinese Pharmacopoeia can be quickly and accurately identified; besides, the pheretima aspergillum and the Shanghai lumbricus can be further distinguished; the accuracy and the reliability can be enhanced; the safety of the lumbricus used as a medicinal material can be guaranteed.

The process of identifying the co-epiphytic dominant bacteria composition and the specific host bacteria of sponge includes the following steps: preparing co-epiphytic microbe macro genome total DNA sample via grinding sponge, treating with lysozyme and proteinase K to release DNA, and phenol-chloroform treatment; PCR amplification with the sample as template and general bacterial primer to obtain 16S rDNA segment smaller than 500 bp; denaturing gradient gel electrophoresis to separate mixed segment and obtain 16S rDNA-DGGE gene fingerprint; recovering DNA bands, secondary PCR amplification, denaturing gradient gel electrophoresis, purification, cloning and sequencing to complete homology and system development analysis; analyzing bands in the DGGE fingerprint to complete the molecular identification of the co-epiphytic dominant bacteria composition; and finding out the differential bands in the DGGE fingerprint to complete the molecular identification of specific host bacteria.

The invention relates to a method for identifying species of edible sea cucumbers based on DNA micro-barcodes. The method extracts sea cucumber genomic DNA, and then uses DNA micro-barcode primers for PCR amplification to obtain a PCR product with a length of 257 bp. The DNA micro-barcode primers are MiniCOI‑F: CATGGCTTTCCCTCGAATGAA; MiniCOI‑R: TAACTCCTGGGGTTCGCATCT. Finally, the sequences of the DNA microbarcode fragments obtained by sequencing were compared at the National Center for Biotechnology Information (NCBI), and species identification was carried out according to the matching similarity of the sequences. The method is easy to operate and has high accuracy. It can identify commercially available sea cucumbers that have been processed and whose morphological characteristics have disappeared, and provides technical support for maintaining the interests of enterprises and consumers as well as normal market order.

The invention provides a method and a system for identifying a histologic origin of body fluids of Chinese population from gene level. The method comprises the following step: detecting the expression status of seven genes: GYPA, SPTB, MMP-7, STATH, MUC4, PRM2 and TGM4 in body fluids, wherein the body fluids comprise one or more of peripheral blood, menstrual blood, saliva, vaginal secretion and seminal fluid. The invention further provides the system for identifying the histologic origin of body fluids of Chinese population from gene level. According to the scheme provided by the invention, the histologic origin of body fluids of Chinese population can be effectively determined from the gene level, so that steps of identifying the histologic origin of body fluids in criminal investigation fields or spots thereof are greatly simplified, and an accurate scientific basis is provided for defining case property, determining criminal suspects, convicting and sentencing and the like.

The invention discloses a DNA barcode, the nucleotide sequence of which is shown in SEQ ID NO.1. The DNA barcode disclosed the ITS sequence of Muscadine grape for the first time, which provided an effective molecular marker for the species identification of Muscadine grape. In addition, the DNA barcode also included some conserved sequences, which is universal when applied to the species identification of grapevine. The invention discloses a method for preparing the nucleotide sequence of the DNA barcode and primers, which can be used to obtain the sequence of the ITS region of muscadine grapes. The invention also discloses a molecular identification method of muscadine grapes, detection primers and a kit for identifying muscadine grapes, using the detection primers or kits to carry out PCR amplification to obtain the sequence of the grape ITS2 region, and then combining the amplified sequence with the muscadine The DNA barcode sequences of grapes are compared or applied to construct a phylogenetic tree of grapes to achieve accurate identification of grape varieties, and the identification process is simple, efficient and repeatable.

The invention relates to a DNA (deoxyribonucleic acid) sequence tag for identifying the sex difference of fenneropenaeus chinensis and an application thereof. High-throughput sequencing is carried out on mixing pools of DNA of female individuals and male individuals respectively by a high-throughput sequencing means, bioinformatics analysis is carried out on the sequencing results to screen DNA sequence fragments with significant difference in the female and male mixing pools, the obtained differential fragments are verified in the female and male individuals from different sources, finally a DNA sequence tag which can be used for identifying the sex of fenneropenaeus chinensis is obtained, and accurate identification of the genetic sex of fenneropenaeus chinensis can be achieved by utilizing the DNA sequence tag. The method has the characteristics of high efficiency, accuracy and reliability and has an extensive application prospect in fenneropenaeus chinensis sex identification, sex determination and differentiation mechanisms and sex control studies.

The invention specifically relates to a PCR amplimer for environmental DNA detection of Chinese sturgeon, a detection method using the PCR amplimer and application of the PCR amplimer, belonging to the field of biotechnology. The sequences of ASCB1F and ASCB1R of the PCR amplimer are 5'-ACAATGCCACCCTTAC-3' and 5'-TGTCTGCGTCTGAGTTT-3', respectively. The site of a DNA molecular marker of a Chinese sturgeon species is located in the mitochondrial CYTB gene of the Chinese sturgeon; a DNA fragment has a length of 138 bp and a sequence as shown in SEQ ID No. 1; the PCR amplimer is used for environmental DNA amplification, an amplification product is compared with the sequence of the site of the DNA molecular marker, and if the non-primer zones of the amplification product and the site sequence are 100% matched, a detected species is the Chinese sturgeon species. According to the invention, identification of the Chinese sturgeon species is realized by using environmental DNA detection, and a sample from a fish body is not needed, so damage to the fish body is avoided.

The invention provides a method for identifying reality and purity of pepper male sterile three-line mating hybrids based on InDel (insertion-deletion) molecular markers. The method includes the steps: culturing the pepper hybrids and parents to a bud and seedling stage; extracting DNA (deoxyribonucleic acid); screening the hybrids and the parents by core primers. Primers of co-dominant markers can serve as molecular markers for identifying the reality of the hybrids, and co-dominant markers of the pepper hybrids and the parents continues to be screened by combining a secondary core primer library until the co-dominant markers are screened out if the co-dominant markers of the pepper hybrids and the parents cannot be screened out in a core primer library. According to the method, a systemcapable of rapidly and simultaneously identifying the reality and the purity of the pepper male sterile three-line mating hybrids is built and cannot be limited by time and seasons, indoor rapid identification of the reality and the purity of the hybrids is achieved, and molecular biology bases are provided for protection and market supervision of the pepper male sterile three-line mating hybrids.

The invention discloses a method for qualitatively detecting adulteration grease in vegetable oil by utilizing stoichiometry. The method comprises the following steps: acquiring gas chromatographic data, and distinguishing the type of adulterated grease in the vegetable oil by utilizing judgment analysis and clustering analysis. According to the method, thirteen judgment analysis models are established, the steps for comparing with the standard vegetable oil map and comparing the content of fatty acid are omitted when a to-be-detected sample is detected, and the ratio of fatty acid is directly substituted to distinguish the type of the adulterated grease, so that the palm oil, colza oil, cotton seed oil, soybean oil, tea seed oil and peanut oil adulterated in rice bran oil can be distinguished, and the detection accuracy is more than 96 percent. More than 9 percent of adulterated palm oil, more than 2 percent of adulterated colza oil, more than 5 percent of adulterated cotton seed oil and more than 16 percent of soybean oil in the rice bran oil can be distinguished through the clustering analysis of the palm oil, colza oil, cotton seed oil and soybean oil adulterated in rice bran oil.

The invention discloses a pair of primers for identifying or assisting in identifying a stored bean elephant and a kit thereof. The primer pair provided by the present invention consists of the following 5 pairs of primer pairs: primer pair 1 (sequence 1 and sequence 2), primer pair 2 (sequence 3 and sequence 4), primer pair 3 (sequence 5 and sequence 6), primer 4 (SEQ ID NO: 7 and SEQ ID NO: 8), primer pair 5 (SEQ ID NO: 9 and SEQ ID NO: 10). Using the kit provided by the invention to identify the species of the stored bean elephant is not affected by the individual growth state of the specimen and the integrity of the sample, and has the advantages of saving time, high efficiency and accuracy. The invention can be widely used in grain storage department and quarantine department.