DNA (deoxyribonucleic acid) sequence tag for identifying genetic sex of fenneropenaeus chinensis and application thereof
A technology of DNA sequence and sequence tag, which is applied in the field of DNA sequence tag to identify the genetic sex of Penaeus prawn, can solve the problems of not being able to distinguish by gender, not being screened for sex identification markers, and not being able to use sex identification, etc., to achieve high accuracy Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0056] Example: A molecular identification method for the genetic sex of Penaeus prawns in China
[0057] In October 2014, 40 Chinese prawns were randomly selected from the Nanshan aquatic product market in Qingdao, and transported to the Aquarium Building of the Institute of Oceanology, Chinese Academy of Sciences for temporary breeding, and then the muscle tissue was taken out and frozen in a -80-degree refrigerator.
[0058] 1. Use the plant genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. (referred to as Tiangen) to extract and label the DNA of the above samples, and refer to the design and instructions for the operation method. The DNA concentration of the extracted DNA was measured using Nanodrop 1000 (Thermo, USA).
[0059] 2. Use the following amplification primers to perform PCR amplification on the extracted DNA,
[0060] FcSDF: TTCTGCCTCCAGAGGGAAAGCCAT
[0061] FcSDR: CCCTGCATCAGGCCCCATAAAGTC
[0062] The amplification system is as...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com