Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA (deoxyribonucleic acid) sequence tag for identifying genetic sex of fenneropenaeus chinensis and application thereof

A technology of DNA sequence and sequence tag, which is applied in the field of DNA sequence tag to identify the genetic sex of Penaeus prawn, can solve the problems of not being able to distinguish by gender, not being screened for sex identification markers, and not being able to use sex identification, etc., to achieve high accuracy Effect

Active Publication Date: 2016-02-24
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF6 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the study of sex markers in prawns, there have been many reports of screening sex markers. Staelense et al. (2008) constructed a high-density genetic linkage map of Penaeus monodon, and found two markers of sex differences from the genetic map, This marker has also been confirmed as a marker for gender identification in other genetically derived Penaeus monodon populations, and the team has also applied for a related patent (sex-specific markers for shrimp and prawns, Chinese invention patent, Application number: 200780015173.9); Zhangetal. (2006) screened a sex-specific microsatellite locus of Litopenaeus vannamei through QTL mapping method, and later confirmed that the microsatellite locus was family-specific, and it was found in individuals from other sources Not applicable; similarly, the study of Alcivar-Warrenetal.(2007) also found sex-specific microsatellite markers of Litopenaeus vannamei, but only in the population studied
However, due to the diversity of different species of prawns, molecular markers of other species cannot be used for sex identification of Penaeus chinensis
In the study of Penaeus prawn, although many linkage maps were constructed, no corresponding sex identification markers were screened (Lietal.2006; Sunetal.2008; Liuetal.2010)
Lietal. (2013) screened a gene differentially expressed between the sexes of Penaeus prawns and developed the marker into a marker that can be used for sex identification of male and female larvae through the method of gene differential expression analysis (Chinese invention patent, publication number: 101709332A), however, this marker is a marker developed at the transcriptome level, which is greatly affected by the growth and development stages of shrimp, and cannot be used for sex differentiation of shrimp before the juvenile stage
DNA markers used for sex identification of Penaeus prawns in China have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA (deoxyribonucleic acid) sequence tag for identifying genetic sex of fenneropenaeus chinensis and application thereof
  • DNA (deoxyribonucleic acid) sequence tag for identifying genetic sex of fenneropenaeus chinensis and application thereof
  • DNA (deoxyribonucleic acid) sequence tag for identifying genetic sex of fenneropenaeus chinensis and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0056] Example: A molecular identification method for the genetic sex of Penaeus prawns in China

[0057] In October 2014, 40 Chinese prawns were randomly selected from the Nanshan aquatic product market in Qingdao, and transported to the Aquarium Building of the Institute of Oceanology, Chinese Academy of Sciences for temporary breeding, and then the muscle tissue was taken out and frozen in a -80-degree refrigerator.

[0058] 1. Use the plant genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. (referred to as Tiangen) to extract and label the DNA of the above samples, and refer to the design and instructions for the operation method. The DNA concentration of the extracted DNA was measured using Nanodrop 1000 (Thermo, USA).

[0059] 2. Use the following amplification primers to perform PCR amplification on the extracted DNA,

[0060] FcSDF: TTCTGCCTCCAGAGGGAAAGCCAT

[0061] FcSDR: CCCTGCATCAGGCCCCATAAAGTC

[0062] The amplification system is as...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a DNA (deoxyribonucleic acid) sequence tag for identifying the sex difference of fenneropenaeus chinensis and an application thereof. High-throughput sequencing is carried out on mixing pools of DNA of female individuals and male individuals respectively by a high-throughput sequencing means, bioinformatics analysis is carried out on the sequencing results to screen DNA sequence fragments with significant difference in the female and male mixing pools, the obtained differential fragments are verified in the female and male individuals from different sources, finally a DNA sequence tag which can be used for identifying the sex of fenneropenaeus chinensis is obtained, and accurate identification of the genetic sex of fenneropenaeus chinensis can be achieved by utilizing the DNA sequence tag. The method has the characteristics of high efficiency, accuracy and reliability and has an extensive application prospect in fenneropenaeus chinensis sex identification, sex determination and differentiation mechanisms and sex control studies.

Description

technical field [0001] The invention relates to the sex identification and sex control technology of prawns in aquatic biology technology, specifically, a DNA sequence tag for identifying the genetic sex of Penaeus prawns in China and its application. Background technique [0002] Penaeus chinensis is an important cultured shrimp in my country. Because of its large individual size and high nutritional value, it has important economic value. Like other types of prawns, there are obvious differences in the size of male and female individuals, and the growth rate of female individuals in the middle and late stages of growth is much higher than that of male individuals. It is of great significance to increase the production of aquaculture and increase economic benefits. [0003] In order to cultivate the unisexual population of Penaeus prawns, it is first necessary to identify the genetic sex of the prawns. Although the sex identification of male and female shrimp can be reali...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6869C12Q1/6888C12Q2600/124C12Q2600/158C12Q2535/101
Inventor 李诗豪李富花相建海
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products