Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

46 results about "Pinctada fucata martensii" patented technology

Breeding method for rapid growing line of seawater pearl shells

The invention relates to a breeding method for a rapid growing line of seawater pearl shells, which comprises the steps of: taking a certain population of Pinctada martensii Dunker as a basic population, firstly selecting individuals with shell width being 10-40 percent higher than average value from the basis population by taking shell width as a selection index, then selecting individuals with shell height or weight being 10-60 percent higher than average value as breeding parents, dissecting the breeding parents, taking sexual glands to conduct artificial insemination, selecting and reserving preparative parents at a young shell stage according to a proportion of 20-30 percent, and finally conducting more than three generations of continuous selection to obtain the rapid-growing large excellent Pinctada martensii Dunker line (variety). The breeding method has the advantages that the method is simple, convenient and feasible, the cost for nursing the parents can be reduced, the growth speed and the individual size of the Pinctada martensii Dunker can be effectively improved and the pearl producing effect is improved.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Shellfish flavor peptide and preparation method thereof

InactiveCN102793138AEnsure food safetyPreserve the Seafood FlavorFood preparationUltrafiltrationFreeze-drying
The invention discloses a shellfish flavor peptide and a preparation method thereof. The method comprises the following steps: using pinctada martensii and Corbicula fluminea as raw materials, and beating; rinsing by using a NaCl solution and filtering to obtain protein; conducting glycosylation: dispersing the protein into the NaCl solution to let the protein uniformly mix with glucan in a proper weight ratio, then conducting freeze drying and dry heating to obtain glucan shellfish protein; conducting enzymatic hydrolysis: adding water in the glucan shellfish protein, adjusting the pH value and the temperature, adding papain and composite protease to conduct enzymatic hydrolysis, after completing the enzymatic hydrolysis, killing enzyme to obtain an enzymoiysis product; carrying out centrifugal filtration on the enzymoiysis product to obtain an enzymatic hydrolysis solution; fermenting to remove fishy smell: carrying out autoclaved sterilization on the enzymatic hydrolysis solution, cooling, inoculating lactic acid bacteria, fermenting to obtain a broth; carrying out ultrafiltration on the broth by using a 5000Da ultrafilter membrane and drying to obtain the flavor peptide. The shellfish flavor peptide prepared by the invention has rich nutrients on the basis of keeping the original taste and guarantees the food safety.
Owner:GUANGDONG SHINYEE MARINE BIOLOGY ENG CORP

Detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of detection primer

The invention discloses a detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of the detection primer. The detection primer comprises the following substances:ASSN815FI: TCCATCGTGGACAAACGTGTAA; ASSN815RI: GTGTCAAAGTAAACTGTATCTCGTGCC; ASSN815FO: TAGAATTGGCAAAGGAACAAGCAT; ASSN815RO: AATAATTCCTAACAGGTGCCCGTC. Through the adoption of the detection primer marked by SNP and associated with pinctada martensi adductor muscle weight, SNP sites of the myostatin genes can be amplified, and the SNP sites are associated with the muscle weight obviously; according to the PCR amplification electrophotogram, the size of the adductor muscle weight between individuals can be compared visually, so that the detection primer can be directly used for follow-up molecular marker assistant breeding, for example, the detection primer can be used for selecting target characters in early growth stage, and then the specific individual is selected for variety breed.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Preparation method of pinctada fucata martensii meat anti-oxidizing oligopeptides

The invention provides a preparation method of pinctada fucata martensii meat anti-oxidizing oligopeptides, which comprises the following steps: (1) selecting pinctada fucata martensii meat to be put into cold water with cold homogenate to obtain a pinctada fucata martensii meat homogenate solution; (2) adding alkali protease in the pinctada fucata martensii meat homogenate solution, mixing uniformly, and carrying out ultrasonic complex enzymolysis; (3) further conducting enzymolysis for the homogenate solution obtained by the ultrasonic complex enzymolysis to continue carrying out constant temperature enzymolysis in water bath, eliminating enzyme after finishing the enzymolysis, and obtaining supernate containing the pinctada fucata martensii meat anti-oxidizing oligopeptides by centrifugal separation after cooling; and (4) gradually separating the supernate containing the pinctada fucata martensii meat anti-oxidizing oligopeptides by adopting 5-10kDa and 1kDa ultrafiltration membranes through membrane separation and purification treatment and collecting the filter liquor to obtain the inctada fucata martensii meat anti-oxidizing oligopeptides solution, and carrying out purification treatment to obtain powder thereof. The method has simple operation and new technique, can greatly improve the hydrolysis rate of the pinctada fucata martensii meat by ultrasonic auxiliary enzymolysis, shortens hydrolysis time and reduces production cost.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

SNP411871 marker associated to shell mould and weight of pinctada martensii, primer and application thereof

The invention discloses a SNP411871 marker associated to shell mould and weight of pinctada martensii, a primer and an application thereof. The primer comprises 411871FI: GGAAACGGAATTCACATTCATTATCTTTA; 411871RI: AATGTCAAGCTGGATATAATTTAGCTCTA; 411871FO: AAATTATTGAAACTATTTCACCGATTCG; and 411871RO: TTGTGATTTCATTTTCGTATCAATATTCTT. According to the invention, a specific SNP genotype site can be amplified by the primer, size of individual shell length and hinge line length as well as weight of soft part and adductor muscle can be visually compared according to a PCR electrophoretogram, nd the primer can be directly used for subsequent molecular mark assisted breeding.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Pinctada martensii antimicrobial peptide PmAMP and application thereof

The invention discloses a pinctada martensii antimicrobial peptide PmAMP and application thereof.The amino sequence of the inctada martensii antimicrobial peptide PmAMP is as shown in SEQ ID No.1.The pinctada martensii antimicrobial peptide PmAMP is characterized in that pinctada martensii is used as the research object, the serum of the pinctada martensii is separated and purified to screen out protein with antimicrobial activity, the obtained pinctada martensii antimicrobial peptide PmAMP can evidently inhibit the growth of escherichia coli and micrococcus luteus, the gene for encoding the antimicrobial peptide PmAMP are obtained through mass spectrum sequencing and using the RACE technology to clone the overall length of cDNA, and the nucleotide sequence of the gene is as shown in SEQ ID No.2 or SEQ ID No.3.When fluorescent quantitative PCR is used to detect the expression content of the PmAMP in tissue, the detection results show that the expression content of the PmAMP is the highest in adductor muscle and low in blood cells.After bacterium stimulation, the expression content of the PmAMP in the blood cells is the highest after 8 hours, so that the PmAMP is immune protein.By the pinctada martensii antimicrobial peptide PmAMP, a foundation is laid for the immunology researches and disease control of the pinctada martensii.
Owner:GUANGDONG OCEAN UNIVERSITY

Method for cultivating pinctada martensi

The invention discloses a method for cultivating pinctada martensi. In the method, the pinctada martensi and chlamys nobilis are cultivated in proportion in the cultivation process. By utilizing the method for cultivating the pinctada martensi disclosed by the invention, the growth rate and survival rate of the pinctada martensi can be obviously improved, biomass liveweight adhered to the pinctada martensi is lowered, the cultivation time of the pinctada martensi is shortened and the economic benefits of products can be enhanced; and the method is suitable for popularization and application in aquaculture.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Pif promoter capable of being activated by pinctada martensii MSX (muscle segment homeobox) gene and application thereof

The invention discloses a Pif promoter capable of being activated by pinctada martensii MSX (muscle segment homeobox) genes and application of the Pif promoter. The nucleotide sequence of the Pif promoter is shown as SEQ ID NO.1. A Pif promoter sequence is obtained through amplification by a genome walking method. The Pif promoter has a binding site 1 and a binding site 2, which can be bound to the MSX genes. Through the establishment of wild type carriers and mutant type carriers of Pif promoters of different fragment lengths, a dual-luciferase reporter gene system is applied to identify the fact that the MSX genes act on the Pif promoter through the binding site 1. The Pif promoter can start the downstream target gene expression, thereby promoting the growth of pearls or pearl oysters.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Selective breeding method for breeding piece shell families of gold pearl layers of pinctada martensi of seawater pearls

The invention relates to a selective breeding method for breeding piece shell families of gold pearl layers of pinctada martensi of seawater pearls, and belongs to the field of selective breeding technologies for pearls. The selective breeding method includes selecting excellent individuals meeting selective breeding targets for seed reservation from base populations with different color types of pearl layers by the aid of inter-family selection and within-family selection processes; creating a plurality of families and reproducing descendents; gradually eliminating inferior families between the families; eliminating inferior individuals in the families generation by generation; selectively reserving excellent families which surpass the base populations and meet original selection indexes; judging strength and weakness of the families by the aid of breeding values and comprehensive evaluation values; selectively breeding novel piece shell strains with high growth speeds and pure-gold edges of pearl layers in shells. The selective breeding base populations are a generation F6 of black shell novel strains of the pinctada martensi, populations of six successive generations are selectively bred to obtain the generation F6 of the novel black shell strains, shell surfaces of the novel black shell strains are provided with pure black radial ribs, and the novel black shell strains are high in growth speed. The selective breeding method has the advantages that the selective breeding method is feasible in principle, simple in step and low in production cost, piece shells of the 'gold lip strains' of the pinctada martensi can be obtained, variety combinations can be provided for producing 'gold pearls', and sustainable development of seawater pearl culture industries in China can be promoted.
Owner:GUANGDONG OCEAN UNIVERSITY

Pinctada martensii micro-encapsulated diet and preparation method thereof

The invention relates to aquatic feeds, and particularly discloses pinctada martensii micro-encapsulated diet and a preparation method thereof. The pinctada martensii micro-encapsulated diet is prepared from core raw materials and wall raw materials, wherein the core raw materials comprise the following components in percentage by weight: 10-15 percent of fish powder, 5-15 percent of enzyme hydrolyzed soybean meal, 40-60 percent of kelp powder, 5-10 percent of yeast autolytic powder, 5-15 percent of spirulina powder, 10-20 percent of alpha-starch, 1-2 percent of compound minerals, 0.3-0.6 percent of vitamin complex and 0.1-0.3 percent of choline. According to the preparation method, the core raw materials and the wall raw materials are grinded and mixed to prepare the micro-encapsulated diet by utilizing a spray-drying method. The micro-encapsulated diet is fully-artificial feed for feeding habits and nutritional requirement of pinctada martensii, and is used for providing raw material guarantee for establishing large-scale industrial aquaculture and pearl production mode of pinctada martensii.
Owner:GUANGDONG OCEAN UNIVERSITY +2

Quality-guaranteed fresh keeping processing method of pinctada martensii meat

The invention discloses a quality-guaranteed fresh keeping processing method of pinctada martensii meat, and belongs to the technical field of processing of marine products. The quality-guaranteed fresh keeping processing method of pinctada martensii meat comprises the working procedures of performing soaking and cleaning in seawater, removing surface mucosa, performing fishy smell removal treatment, performing sterilization treatment, performing precooling treatment, performing soaking treatment in quality-guaranteed fresh keeping liquid, performing vacuum packing and the like. The quality-guaranteed fresh keeping processing method of pinctada martensii meat provided by the invention can perform quality-guaranteed fresh keeping processing on the pinctada martensii meat, people in inland remote districts can taste the primary taste of the pinctada martensii meat, nutrients and moisture can be guaranteed not to flow out, at the premise that mouth feel is guaranteed, storage time can beprolonged, the haul distance can be enlarged, the supply cycle of seafood can be prolonged, and the transport cost can be saved. In the processing treatment course, the quality-guaranteed fresh keeping processing method is free from any materials harmful to human bodies, and the eating safety of the pinctada martensii meat can be guaranteed.
Owner:北海市万山海投资有限公司

Staged low-specific-gravity mariculture method for pinctada martensii pearl culturing shellfish

The invention discloses a staged low-specific-gravity mariculture method for pinctada martensii pearl culturing shellfish. The method comprises the steps as follows: selecting a culture pond, treating the culture pond, culturing the pearl culturing shellfish, harvesting pearls and the like, and the method specifically comprises the following steps: cleaning the pearl culturing shellfish which is cultured for 7-8 months in a sea area and is 3-4 months before pearl harvesting, and transferring the pearl culturing shellfish to the culture pond for hanging culture. The specific gravity of seawater in a culture water body is reduced, rapid growth and reproduction of unicellular algae in the water body are promoted through low-specific-gravity seawater, sufficient bait supply is provided for growth of the pinctada martensii, growth of the pinctada martensii is promoted, and the nacre secretion speed of the pinctada martensii is increased so as to increase the thickness of a nacre layer; and the pinctada martensii pearls produced with the culture method have large pearl layer thickness, the economic benefits of pinctada martensii pearl culture can be increased, and the staged low-specific-gravity mariculture method for the pinctada martensii pearl culturing shellfish is easily popularized and applied in pearl production enterprises and farmers and has remarkable social benefits and economic benefits.
Owner:GUANGDONG OCEAN UNIVERSITY

Process for preparing antioxidant peptides from pinctada martensii by adopting fermentation method

The invention discloses a process for preparing antioxidant peptides from pinctada martensii by adopting a fermentation method. The process comprises the following steps: firstly, pretreating pinctada martensii into dry powder, secondly, inoculating microorganism strains for fermented cultivation, and performing concentration and spray drying on supernate of fermentation liquor to obtain a pinctada martensii antioxidant peptide product. By the adoption of the microorganism fermentation method for preparing the antioxidant peptides from the pinctada martensii, the problem that a conventional enzyme method is high in cost is solved; meanwhile, the process has the characteristics of easy control over preparation conditions, low cost and good flavor of fermentation products; furthermore, the pinctada martensii is subjected to deep processing to obtain the antioxidant peptides, so that a great signification for the development of the aquatic product industry and improvement of the additional value of the pinctada martensii can be achieved; meanwhile, the obtained antioxidant peptides are nutrient and healthy, and achieve a certain effect of promoting the health of social residents.
Owner:LINGNAN NORMAL UNIV

Application of Pinctada martensii mucus in extraction of exosome, exosome as well as extraction method and application of exosome

The invention provides application of pinctada martensii mucus to extraction of exosomes, the exosomes and an extraction method and application of the exosomes. According to the method, the vesicular nanoparticles are separated from the pinctada martensii mucus by adopting an ultracentrifugation method and are identified as the exosome, so that reference is provided for extracting the bioactive exosome from marine organisms, and meanwhile, the utilization value of the pinctada martensii is also improved. The exosome extracted from the pinctada martensii mucus can enhance the cell viability, reduce the ROS level in cells, inhibit the activation of NF-kappa B and NLRP3 pathways and reduce the expression level of related inflammatory factors mRNA, and has a certain anti-inflammatory effect.
Owner:GUANGDONG OCEAN UNIVERSITY +1

Microsatellite marker primers used for pinctada fucata martensii microsatellite family identification, identification method and application

The invention discloses microsatellite marker primers used for pinctada fucata martensii microsatellite family identification. The microsatellite marker primers include nine primer pairs in total, and the nine primer pairs are PF-3, PF-4, PF-11, PF-13, PF-16, PF-27, PF-30, PF-44 and PF-48 respectively. The invention further discloses an identification method for the pinctada fucata martensii microsatellite family and application of the microsatellite marker primers to pinctada fucata martensii microsatellite family identification. By the adoption of the microsatellite marker primers, a paternity test platform is set up on pinctada fucata martensii with polymorphic microsatellite markers marked by fluorescence for the first time, and the identification accuracy reaches 90.24%; different families and sources of the pinctada fucata martensii can be effectively and fast identified, and a basis is provided for breeding, reproduction matching and enhancement and releasing assessment of the pinctada fucata martensii.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Culture method of luminous pearl

The invention relates to a culture method of luminous pearl. The culture method comprises the following steps: selecting immature and healthy seawater pinctada martensi or freshwater hyriopsis cumingii of one year's old as a mother shell; cutting down cell slices from the pinctada martensi or hyriopsis cumingii; taking fluorite granules ground into round as pearl nucleus; implanting the fluorite granules and the cell slices as pearl nucleuses in the stomach of the mother shell; culturing the mother shell with seawater or freshwater for 7-9 months to form nacre on the pearl nucleus, and takingout the mother shell to obtain the luminous pearl. Fluorite is used as the pearl nucleus, the cultured pearl can shine in a dark place, the cultured pearl has high hardness and is not easy to wear, the product gloss is high, bleaching and brightening tretament is not required, and the luminous pearl is good in environmental protection performance, harmless to the human body and suitable for wearing.
Owner:冯小奔

Pinctada martensi lectin PmCLEC-1 and application thereof

The invention belongs to the technical field of genetic engineering, and particularly discloses pinctada martensi lectin PmCLEC-1 and application thereof. The amino acid sequence of the pinctada martensi lectin PmCLEC-1 is as shown in the SEQ ID NO:1; and the nucleotide sequence of the pinctada martensi lectin PmCLEC-1 is as shown in the SEQ ID NO:2 or 3. Furthermore, the pinctada martensi lectin PmCLEC-1 has an effect of inhibiting growth of colibacillus and micrococcus luteus, and has excellent application prospects.
Owner:GUANGDONG OCEAN UNIVERSITY

Pinctada martensii superoxide dismutase (PmECSOD) and application thereof

The invention belongs to the technical field of genetic engineering, and particularly discloses pinctada martensii superoxide dismutase (PmECSOD) and an application thereof. The amino acid sequence of the PmECSOD is shown as SEQ ID NO:1; the nucleotide sequence of a PmECSOD gene is shown as SEQ ID NO:2 or SEQ ID NO:3. Compared with traditional SOD, the PmECSOD has many differences and is new SOD through preliminary identification, and the PmECSOD has the effects of inhibiting growth of escherichia coli and growth of micrococcus luteus and has good application prospects.
Owner:GUANGDONG OCEAN UNIVERSITY

Method for producing shell-attached pearls and regenerative cell pearls by using pinctada martensii golden lip system pearl culture shellfish

The invention discloses a method for producing shell-attached pearls and regenerative cell pearls by using pinctada martensii golden lip system pearl culture shellfish. When pearls of the pinctada martensii golden lip system pearl culture shellfish are harvested, pearl culture shellfish which are large in size, regular in shell shape, full in visceral mass and good in growth in the same batch of pearl culture shellfish are selected, the nucleus-reserved shellfish is inspected through an X-ray machine and subjected to anesthesia treatment, free pearls meeting the quality requirement are suckedout through a minimally invasive operation, and pearl sacs are stored; regenerated cell pears are generated by utilizing the preserved pearl sac secreted nacres, and simultaneously to be pasted on a shell-attached pearl model to produce shell-attached pearls; the shell-attached pearl model is directly attached to produce shell-attached pearls after anesthesia treatment of the enucleated shells, the pearl-cultured shells are returned into a sea area for culturing pearls after operation, and harvesting of the shell-attached pearls and regenerated cell pearls / or the shell-attached pearls is realized after culturing for 12-15 months. According to the method, the utilization rate of pearl culture of pinctada martensii can be increased, and the economic benefit of pearl culture is increased.
Owner:广东荣辉珍珠养殖有限公司

Fertilization breeding method for developing pinctada martensii with yellow inner shells into nacre with dark yellow golden inner shells

The invention discloses a fertilization breeding method for developing pinctada martensii with yellow inner shells into nacre with dark yellow golden inner shells. The fertilization breeding method comprises the following steps: 1) selecting male pearl shells and female pearl shells with dark yellow inner shells from a batch of pinctada martensii, performing fertilization breeding in a natural fertilization or artificial fertilization mode, performing separated hanging breeding on the obtained pinctada martensii seeds, and enabling the pearl shells to grow rapidly; 2) at the same stage of a next year, selecting the pinctada martensii seeds, discarding qualified pearl shell seeds such as pearl shells with milky white inner shells and light yellow inner shells, retaining male pearl shells and female pearl shells with dark yellow inner shells, performing breeding again, performing hanging breeding on pearl shell seeds obtained through breeding, and enabling the pearl shell seeds to grow healthily and rapidly; and (3) performing elimination breeding for five generations, and starting pearl breeding when pinctada martensii shells with dark yellow inner shells accounts for about 90% of the obtained pinctada martensii seeds. Pearls bred in the pinctada martensii shells with the dark yellow inner shells are of dark yellow colors or thick golden colors with pearly luster.
Owner:广东荣辉珍珠养殖有限公司

Pinctada martensi Kunitz-type serine protease inhibitor gene, coded protein and application

The invention provides a pinctada martensi Kunitz-type serine protease inhibitor gene, coded protein and application, and belongs to the technical field of application of protein. A nucleotide sequence of the pinctada martensi Kunitz-type serine protease inhibitor gene is shown in SEQ ID No.1 as shown in the description, and an animo acid sequence of the coded protein is shown in SEQ ID No.2 as shown in the description. The provided protein coded by the gene has inhibiting effects on escherichia coli, pseudomonas aeruginosa, aeromonas hydrophila, vibrio parahemolyticus and vibrio harveyi.
Owner:GUANGDONG OCEAN UNIVERSITY

A SNP298299 marker significantly associated with soft body weight and adductor muscle weight of Pinctada martensii and its primers and applications

The invention discloses an SNP298299 marker significantly correlated with a pinctada martensii mollusc part weight and an adductor muscle weight, as well as and primers and application of the SNP298299 marker. The primers comprise 298299FI: GGAATTCGTATCACTGTTTGAAGCAAGG, 298299RI: GGGAACACATCCCACATTTAACAATGTTA, 298299FO: TTGATAGCGGAATAGGCACATTCAATTT, and 298299RO: TTAAAAGGCAAAGAAAACTTTGGCATCAG. Two types of SNP (single nucleotide polymorphism) genotype loci can be amplified by utilizing the primers disclosed by the invention and then according to a PCR (Polymerase Chain Reaction) electrophoretogram, the mollusc part weight and the adductor muscle weight can be visually compared between individuals; and the primers can be directly used for subsequent molecular marker assistant breeding.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

A snp411871 marker associated with shell type and weight size of Pinctada martensii and its primers and applications

The invention discloses a SNP411871 marker associated to shell mould and weight of pinctada martensii, a primer and an application thereof. The primer comprises 411871FI: GGAAACGGAATTCACATTCATTATCTTTA; 411871RI: AATGTCAAGCTGGATATAATTTAGCTCTA; 411871FO: AAATTATTGAAACTATTTCACCGATTCG; and 411871RO: TTGTGATTTCATTTTCGTATCAATATTCTT. According to the invention, a specific SNP genotype site can be amplified by the primer, size of individual shell length and hinge line length as well as weight of soft part and adductor muscle can be visually compared according to a PCR electrophoretogram, nd the primer can be directly used for subsequent molecular mark assisted breeding.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

A method for improving the nucleus retention rate and high-quality pearl rate of Pinctada martensii

The invention discloses a method for improving the nucleus retaining rate and high-quality pearl rate of nucleus implanted Pinctada martensii, and belongs to the technical field of aquaculture. The method comprises the basic steps of: preparation of nucleus implanting tools and a pearl nucleus disinfection solution, preparation of a mantle piece maintenance solution, selection of nucleus implanting Pinctada martensii, disinfection treatment of the nucleus implanting tools and pearl nuclei and maintenance treatment of mantle pieces, wherein during nucleus implanting and pearl producing of the Pinctada martensii, the nucleus implanting tools and pearl nuclei of the Pinctada martensii are disinfected, the mantle pieces are treated by using the maintenance solution, healthy Pinctada martensiiof 1.5-2 years old is selected as mother molluscs for implanting, and 1.0-year-old molluscs are adopted as mantle-piece molluscs for nucleus implanting and pearl producing; after implanting is conducted, the implanted Pinctada martensii produced by using the method has fast recovery, a high nucleus retaining rate and a high high-quality pearl rate, and the quality and yield of pearls of the pearlproducing molluscs can be improved, so that the benefit of pearl producing is improved; the method is applicable to nucleus implanting and pearl producing of the Pinctada martensii, can be promoted easily in production enterprises and farmers, and has significant social and economic benefits.
Owner:广东尊鼎珍珠有限公司

Microsatellite marker primers and identification methods and applications for identification of microsatellite families of Hepu pinnacle oyster

The invention discloses microsatellite marker primers used for pinctada fucata martensii microsatellite family identification. The microsatellite marker primers include nine primer pairs in total, and the nine primer pairs are PF-3, PF-4, PF-11, PF-13, PF-16, PF-27, PF-30, PF-44 and PF-48 respectively. The invention further discloses an identification method for the pinctada fucata martensii microsatellite family and application of the microsatellite marker primers to pinctada fucata martensii microsatellite family identification. By the adoption of the microsatellite marker primers, a paternity test platform is set up on pinctada fucata martensii with polymorphic microsatellite markers marked by fluorescence for the first time, and the identification accuracy reaches 90.24%; different families and sources of the pinctada fucata martensii can be effectively and fast identified, and a basis is provided for breeding, reproduction matching and enhancement and releasing assessment of the pinctada fucata martensii.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Pinctada martensii pearl cultivation shellfish recuperation method

The invention discloses a pinctada martensii pearl cultivation shellfish recuperation method, and belongs to the technical field of aquaculture. The method comprises the following steps: transferring pearl shells subjected to a nucleus implantation operation to a recuperation pool for cultivation, keeping microwave inflation, starting to feed from the third day after the operation, feeding in the morning and evening every day, feeding chrysophyceae and microcapsule feed as food for the pearl shells, and feeding vitamin D and lysine hydrochloride as nutrition additives, wherein the cultivation density of the pearl shells is 100-120 / m < 3 >, and the hanging water depth is 1.0-1.2 m; in the nucleus implanting and pearl culturing process of the pinctada martensii, seawater filtered by a fine sand layer and shell powder is used as postoperative recuperation water for nucleus implanting of the pinctada martensii, and the specific gravity of the seawater is set to be 1.020-1.025; by adopting the method for post-operation recuperation of the Pinctada martensii, the survival rate of the Pinctada martensii is high, the nucleus reserving and pearl forming rate is high, and the method is suitable for post-operation recuperation of the seawater Pinctada martensii, easy to popularize and apply in production enterprises and good in economic benefit and social benefit.
Owner:GUANGDONG OCEAN UNIVERSITY

Single nucleotide polymorphism (SNP) molecular marker of pinctada fucata martensii growth trait-related pinctada fucata martensii molluscan insulin-related peptide (MIP) gene and application of SNP molecular marker

The invention discloses a single nucleotide polymorphism (SNP) molecular marker of a pinctada fucata martensii growth trait-related pinctada fucata martensii molluscan insulin-related peptide (MIP) gene and application, and belongs to the technical field of molecular marker assisted breeding. The locus corresponds to a gene locus of pinctada fucata martensii molluscan insulin-related peptide (MIP), and an SNP locus of the molecular marker corresponds to a base A or G at the locus 38363939 or a base C or T at the locus 38364205 on the chromosome 3 of pinctada fucata martensii. The SNP marker ofthe invention is significantly related to the growth traits (shell length, shell width, shell height, shell weight and total weight) of pinctada fucata martensii, and is two new molecular markers; bydetermining the SNP locus genotype of to-be-detected pinctada fucata martensii, early breeding is performed on the growth traits of pinctada fucata martensii, so that the breeding cycle is shortened,the genetic progress is improved, and the production cost is reduced; and the SNP molecular marker has obvious economic and social benefits.
Owner:GUANGDONG OCEAN UNIVERSITY

Breeding method of pinctada martensii growth character improved variety based on whole genome selection

The invention discloses a breeding method of a pinctada martensii growth trait improved variety based on whole genome selection. The breeding method comprises the following steps: selecting a reference group by measuring phenotypes; obtaining SNP locus information in a whole genome range by using a sequencing technology; three methods of rrBLUP, BayesA and BayesB are used for estimating the effect value of the SNP, and the accuracy is analyzed; and estimating the GEBV of each individual in the reference group. According to the method, the pinctada martensii can be selected in the early stage, the breeding period is shortened, the investment is reduced, the character selection accuracy can be improved, and factors influencing the environment are reduced. The GEBV obtained by using the method can be used as a standard for breeding improved varieties with growth traits, an effective molecular breeding method is provided for breeding excellent varieties of Pinctada martensii with excellent growth traits, the growth traits, the breeding yield and the breeding quality of the Pinctada martensii are improved, and green and healthy development of the breeding industry of the Pinctada martensii is promoted.
Owner:GUANGDONG ZHANJIANG PROVINCIAL LAB OF SOUTHERN MARINE SCI & ENG +1

Breeding method of a new cultured strain of Pinctada martensii with high carotenoid content

The invention discloses a cultivating method of a new breeding strain of pinctada martensii with high carotenoid content. The cultivating method comprises the basic steps of parent selection, population construction, larval cultivation, sea area breeding and multi-generation population selection, and the new breeding strain of pinctada martensii with the high carotenoid content can be cultivated; for the obtained new strain, prismjatic layers of 96% of individuals are golden yellow, pallia, adductor muscles and gill filaments of 96% of the individuals are golden yellow, and the carotenoid content in pinctada martensii is 2-5 times that of control population. The new strain of pinctada martensii with the high carotenoid content is cultivated through a population selection breeding technology, obvious golden yellow is achieved, and the carotenoid content in pinctada martensii is high; the method is easy to popularize in production units and has a significant practical value and economic value.
Owner:GUANGDONG OCEAN UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More