Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pif promoter capable of being activated by pinctada martensii MSX (muscle segment homeobox) gene and application thereof

A technology of Pinctada martensii and promoter, applied in the field of Pif promoter

Active Publication Date: 2014-05-28
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

How it is regulated to participate in shell or pearl biomineralization has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pif promoter capable of being activated by pinctada martensii MSX (muscle segment homeobox) gene and application thereof
  • Pif promoter capable of being activated by pinctada martensii MSX (muscle segment homeobox) gene and application thereof
  • Pif promoter capable of being activated by pinctada martensii MSX (muscle segment homeobox) gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Example 1: MSX activates the promoter of the pearl shell formation gene Pif

[0017] (1), Cloning and analysis of Pif promoter

[0018] Extract the genomic DNA of Pinctada martensii, design specific primer 1 (5′-TTGTGTCGGTGTCAAATCTG-3′) and nested primer 2 (5′-GCAAGTTCCATCTATTCGAGTTG-3′) according to the existing Pif gene sequence, and follow the genome walking kit (purchased from Clontech, USA) instructions to amplify the Pif promoter sequence. The 20 μl reaction system is: 8 μl of water, 10 μl of 2×PrimerSTAR enzyme premix (purchased from TaKaRa Japan), 0.5 μl of upstream and downstream primers, and 1 μl of template. The specific PCR reaction program was denaturation at 94°C for 15s; renaturation at 55°C for 15s; extension at 72°C for 2min; a total of 33 cycles. After the amplified product is sequenced, use the TRANSFAC website to predict the binding site and core sequence. The nucleotide sequence of the Pif promoter is shown in SEQ ID NO.1, with a full length of 13...

Embodiment 2

[0027] Example 2: After MSX is inhibited, the expression of Pif and the change of the structure of the pearl shell are identified to regulate the process of shell biomineralization

[0028] There were three groups: MSX dsRNA injection group, negative control GFP dsRNA injection group and blank control PBS injection group. Five second-year-old Pinctada martensii were injected into each group. Primer MSXF was designed according to the MSX gene sequence: GCGTAATACGACTCACTATAGGGAGA TTCATGGATCTCCAAAGACAAT and MSXR: GCGTAATACGACTCACTATAGGGAGA ATGGTGATACGTCATACCTACG, design primer GFPF according to GFP gene sequence: GCGTAATACGACTCACTATAGGGAGA ATGGTGAGCAAGGGCGAGGAG and GFPR: GCGTAATACGACTCACTATAGGGAGA TTACTTGTACAGCTCGTCCATG. Underlined is the T7 promoter sequence. Use pCDNA3.1-MSX expression vector as template, MSXF / MSXR as primers, amplify 648bp MSX fragment; use pEGFP-C1 (purchased from Clontech, USA) as template, GFPF / GFPR as primers, amplify 718bp GFP fragment . Using ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Pif promoter capable of being activated by pinctada martensii MSX (muscle segment homeobox) genes and application of the Pif promoter. The nucleotide sequence of the Pif promoter is shown as SEQ ID NO.1. A Pif promoter sequence is obtained through amplification by a genome walking method. The Pif promoter has a binding site 1 and a binding site 2, which can be bound to the MSX genes. Through the establishment of wild type carriers and mutant type carriers of Pif promoters of different fragment lengths, a dual-luciferase reporter gene system is applied to identify the fact that the MSX genes act on the Pif promoter through the binding site 1. The Pif promoter can start the downstream target gene expression, thereby promoting the growth of pearls or pearl oysters.

Description

Technical field: [0001] The invention belongs to the fields of aquatic science and genetic engineering, and in particular relates to a Pif promoter which can be activated by Pinctada martensii MSX gene and an application thereof. Background technique: [0002] Pinctada martensii is an important marine economical bivalve mollusc, mainly used to cultivate seawater pearls. In my country, this species is mainly distributed in the coastal areas of southern Guangdong, Guangxi and Hainan, with an annual economic output value of more than 1 billion yuan. The formation of shells and pearls of Pinctada martensii is a typical biomineralization process and has a similar mechanism. According to the current knowledge and understanding, the main component of shells and pearls is calcium carbonate, accounting for more than 95%. and a small amount of organic matter, and it is believed that the formation of shells and pearls is mainly regulated by a shell matrix protein of organic matter, wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/85
Inventor 何毛贤赵密
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More