Detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of detection primer
A technology of Pinctada martensii and adductor muscle weight, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, biochemical equipment and methods, etc., and can solve the problems of lack of good varieties, uneven quality of seedlings, and breeding environment. Deterioration and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Randomly take 50 Pinctada martensii individuals from the same group, after cleaning, take the adductor muscle tissue and weigh it with an electronic balance and record one by one, and then take a small piece of adductor muscle tissue and put it in 95% in ethanol and stored at -20°C. HiPure Universal DNA Kit (Guangzhou Meiji Biological Co., Ltd.) was used to extract the genomic DNA of the adductor muscle. For related operations, refer to the kit instructions. After the DNA was extracted, its integrity was detected by electrophoresis on 1.0% agarose gel, and the concentration and purity of the DNA were measured by an ultraviolet spectrophotometer, and stored at -20°C.
[0026] The detection primers for the SNP marker associated with adductor muscle weight of Pinctada martensii are:
[0027] ASSN815FI: TCCATCGTGGACAAACGTGTAA;
[0028] ASSN815RI:GTGTCAAAGTAAACTGTATCTCGTGCC;
[0029] ASSN815FO:TAGAATTGGCAAAGGAACAAGCAT;
[0030] ASSN815RO: AATAATTCCTAACAGGTGCCCGTC
[003...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap