48results about How to "Realize closed tube operation" patented technology

The invention provides a high-resolution-melting (HRM)-based grass carp reovirus (GCRV) II type vaccine strain and wild strain differential diagnosis and detection primer. The differential diagnosis and detection primer comprises the following pair of primers: HRM-II-F: 5'CACCGGAGTTAAACTTCATCGC-3'(SEQ ID NO: 1) and HRM-II-R: 5'CCTGTGGCAGACCGGCAGATAA 3'(SEQ ID NO: 2), and is obtained through designing according to a GCRV II type vaccine strain and a known II type wild strain S2 gene 5' end and 3' end conserved domains, one or more stationary base mutation sites exist or exists between the vaccine strain and a wild strain amplified product, the mutation sites are unique for the vaccine strain, identification and analysis of HRM to the GCRV II type vaccine strain and the wild strain are achieved, moreover, a corresponding detection agent and a corresponding detection method are designed according to the HRM-based GCRV II type vaccine strain and wild strain differential diagnosis and detection primer, and the practicability of the technology is improved.