48results about How to "Realize closed tube operation" patented technology

The invention discloses primer, a reagent box and a method for detecting salmonella and integrin (int). The primer comprises upstream primer SLMF: TGCGTCAGGACCTCATAG, downstream primer SLMR: ATGCCTGGAGGAGTGTTT, upstream primer intF: TTTACGCTGCTGTATGGT, and downstream primer intR for detecting int: TTATTGCTGGGATTAGGC. The reagent box is filled with 10 uL of HRM reaction premix liquid, 0.2-3.4 uL of primer, 1 uL of DNA template and is filled into 20 uL by water. The detecting method includes extracting sample DNA and performing PCR amplification. After amplification, products are subjected to high-resolution melting curve analysis, and results are judged by an amplification curve. The reagent box is reasonable in component and proportion, is convenient to use and quick and accurate to detect, the method is convenient and quick to operate, and low in cost, and detecting results are accurate.

The invention provides a method for identifying five dermatophytes by utilizing a high-resolution melting curve and belongs to the technical field of high-resolution melting curve analysis. The methodadopts a pair of specific primers and is based on real-time fluorescence PCR melting curve to identify trichophyton rubrum, trichophyton digitorum, epidermophyton floccosum, microsporum caninum and Microsporum incurvatum. The sequence of the pair of specific primers is as shown as SEQ ID NO.1-2. The method has the advantages of high sensitivity, good specificity and high detection speed, can be used for identifying dermatophytes on the aspects of clinical diagnosis, environmental monitoring, food safety and the like, and provides a reliable basis for infection treatment, environmental sanitation and food safety monitoring of dermatophytes.

The invention provides a fluorescent molecular marker of a rice waxy gene Wx and application of the fluorescent molecular marker. Primers of the fluorescent molecular marker comprise an RWx-FG primer,an RWx-FT primer, an RWx-R primer, a first universal primer and a second universal primer, wherein the sequence of the RWx-FG primer is shown in SEQ ID NO:1, the sequence of the RWx-FT primer is shown in SEQ ID NO:2, the sequence of the RWx-R primer is shown in SEQ ID NO:3, the sequence of the first universal primer is shown in SEQ ID NO:4, and the sequence of the second universal primer is shownin SEQ ID NO:5. According to the technical scheme, a test sample is subjected to PCR amplification only once, no electrophoresis detection is required, and amplification data is obtained by directlyusing a fluorescence scanner on an original plate; the operation is simple, convenient and rapid, the cost is low, the result is accurate, and the real closed-tube operation is achieved.

The invention relates to the field of species identification, and provides an aedes albopictus and aedes aegypti CYTB gene identification kit based on a high-resolution melting curve and an identification method thereof. The aedes albopictus and aedes aegypti CYTB gene identification kit based on the high-resolution melting curve is characterized in that universal primers are designed according toaedes albopictus and aedes aegypti CYTB gene sequences, and an optimized high-resolution melting curve reaction system is adopted to identify aedes albopictus and aedes aegypti of various forms suchas imagoes, ova, larvae and pupae. By the adoption of the aedes albopictus and aedes aegypti CYTB gene identification kit based on the high-resolution melting curve and the identification method thereof, aedes albopictus and aedes aegypti can be identified; operation is easy, the speed is high, no PCR products need post-treatment, the difference of a single base can be detected, and closed-tube operation is indeed achieved.

The invention discloses a kit and a detection method for detecting endogenus component from a bear by means of fluorescence PCR. The kit comprises a forward primer 5'-CGCTAATCTTCTCTATCCTA-3', a reverse primer 5'-CTGTCCGATAATGGTGAA-3', and a probe 5'-(FAM)ATGTTCTACTGGTTGTCCTCCGATT (Eclipse)-3'. The detection method comprises the steps: extracting sample DNA; performing fluorescence PCR amplification on the sample DNA; performing HRM analysis on the amplified product and determining a result. According to the kit and the detection method, a detection process is simplified, and other analyzing devices are not needed for the PCR product in a whole process, so that stopped pipe operation is realized, and crossing contamination is avoided. A good method for accurately and quickly detecting the endogenus component from the bear can be supplied instead of a traditional method for recognizing a bear gall by sense organs, and has a good application prospect.

The invention discloses a method for detecting Enterobacter sakazakii by employing non-labeled fluorescence PCR technology and HRM analysis technology. The method is characterized by comprising the following steps: A, designing a primer pair according to the OmpA gene of Enterobacter sakazakii; B, after sample DNA is extracted, carrying out non-labeled fluorescence PCR amplification by using the designed primer pair; and C, carrying out HRM typing analysis on PCR amplification products by using a fluorescence ration PCR instrument with an HRM module so as to determine the genotype of Enterobacter sakazakii. The objective of the invention is as follows: to overcome disadvantages in the prior art, the method for detecting Enterobacter sakazakii by employing non-labeled fluorescence PCR technology and HRM analysis technology with the advantages of simple and rapid operation, accurate detection results and low usage cost is provided.

The invention discloses a method for detecting polymorphism of a TREM2 gene, wherein the method includes the following steps: determining a mutation site of the TREM2 gene; designing and synthesizinga probe and primers according to the mutation site; mixing the detected TREM2 target gene, the probe, the primers and enzymes, carrying out fluorescence quantitative PCR, and monitoring a fluorescencesignal; and calculating the Tm value displayed by hybrid peaks, and judging the type of the TREM2 gene according to the Tm value. The invention also discloses the probe for detecting the polymorphismof the TREM2 gene, and the probe has the nucleotide sequence including SEQ ID NO.3. The invention provides the probe and method for simple operation and rapid detection of the polymorphism of the TREM2 gene.

The invention discloses a kit for detecting eight staphylococcus aureus drug-resistance genes and a detection method. The kit is characterized in that a reaction system in a non-marked fluorescence PCR amplification process consists of an HRM reaction pre-mixing liquid, a dNTPs mixed liquid, Tag polymerase, an upstream primer, a downstream primer, fluorochrome, a DNA template and water. The detection method is characterized by comprising the following steps: A, designing a primer pair according to the eight staphylococcus aureus drug resistance genes; B, extracting sample DNA, and performing fluorescence PCR amplification according to the designed primer pair; and C, performing HRM analysis on a PCR amplification product by using a fluorogenic quantitative PCR with an HRM module, confirming the Tm value of the amplification product, and judging the result. The invention aims at providing a method which is simple, convenient and rapid to operate and low in cost and is used for detecting eight drug resistance genes by using multi-fluorescence PCR, and the detection result is accurate.

The invention discloses primer, a reagent box and method for detecting staphylococcus aures and mecA. The primer comprises gltBF:TAATCTTTAGTAGTACCGAAGC, gltBR: GGATAATGAAGGGAAACC, mecAF:GTTGTAGTTGTCGGGTTT, and mecAR:TTTATCGGACGTTCAGTC. The reagent box is filled with 10 uL of HRM reaction premix liquid, 0.2-3.4 uL of primer, 1 uL of DNA template and is filled into 20 uL by water. The detecting method includes extracting sample DNA, and subjecting sample DNA in the step A to PCR (polymerase chain reaction) amplification by means of the reagent box; after amplification, products are subjected to high-resolution melting curve analysis, and results are judged by an amplification curve. The reagent box is reasonable in component and proportion, is convenient to use and quick and accurate to detect, the method is convenient and quick to operate, and low in cost, and detecting results are accurate.

The invention relates to a method for detecting hereditary thoracic aortic aneurysm and dissecting associated gene mutation, in particular to a method for detecting TGFBR1, TGFBR2 and ACTA2 gene mutations by using multiple oligonucleotide connection detection probes and liquid-phase chips. The method comprises the following steps: (a) designing and manufacturing a group of multiple oligonucleotide connection detection probes for 13 mutation sites of the TGFBR1, TGFBR2 and ACTA2 genes, wherein the multiple oligonucleotide connection detection probes have the nucleotide sequences of SEQ ID No. 1 and SEQ ID No. 26; (b) carrying out DNA (deoxyribonucleic acid) sample denaturation, probe hybridization and ligation reaction; (c) carrying out PCR (polymerase chain reaction) amplification to the sequences of the multiple oligonucleotide connection detection probes by using universal primers; and (d) detecting the products of amplification by using the liquid-phase chips. The technology can realize the single-tube reaction detection to dozens of mutation sites, is high in throughput and low in cost, and is easy to operate.

The invention specifically discloses a primer and a kit for quickly detecting transgenic maize PAT. The primer comprises an inner reference primer pair and an exogenous gene primer pair; the primer pair in the kit comprises the inner reference primer pair and the exogenous gene primer pair; a reaction system component in the kit comprises HRM reaction premixed solution, the inner reference primer pair, the exogenous gene primer pair, a reaction template and deionized water. The primer is reasonable in component and proportion, is quick and convenient in detection, is high in accuracy and is suitable for fluorescence PCR detection for Zein gene and PAT gene of transgenic sorghum. The detection sensitivity of the primer is higher and can reach up to 0.1%; the stability is higher; the logarithm value of template concentration and the Cp value have an excellent linear relation: R2 more than or equal to 0.96; the accuracy of the detection result of the primer is as high as about 98%; the operation step is simplified according to the invention, so that the detection period is shortened, the quantitative analysis can be realized and the application value is higher.

The invention discloses a probe, primer and kit for detecting AK4 gene polymorphism. The sequence of the probe is shown as SEQ ID NO.: 1, SEQ ID NO.: 4 or SEQ ID NO.: 7, or the two ends of each of the sequences of SEQ ID NO.: 1, SEQ ID NO.: 4 and SEQ ID NO.: 7 are subjected to group modification. The probe, primer and kit for detecting the AK4 gene polymorphism have the advantages of high sensitivity, good specificity, rapidness, high-throughput detection and the like during detection of AK4 gene polymorphism.