Fluorescent molecular marker of rice waxy gene Wx and application of fluorescent molecular marker
A technology of rice wax gene and fluorescent molecules, which is applied in the measurement/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of cumbersome process, low efficiency, and long time consumption, and achieve accurate results and low cost , the effect of easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0030] The preferred embodiments of the present invention will be further described in detail below.
[0031] A fluorescent molecular marker of the rice waxy gene Wx, which is obtained by amplifying the following fluorescent molecular marker primers of the rice waxy gene Wx to identify the waxy allele Wx a and Wx b The schematic diagram of the amplification is as figure 1 shown. Primers include RWx-FG primers, RWx-FT primers, RWx-R primers, #1 universal primers, #2 universal primers, the sequence of the RWx-FG primers is shown in SEQ ID NO: 1, and the RWx-FT primers The sequence of the RWx-R primer is shown in SEQ ID NO: 2, the sequence of the RWx-R primer is shown in SEQ ID NO: 3, the sequence of the #1 universal primer is shown in SEQ ID NO: 4, and the #2 universal primer The sequence of the primer is shown in SEQ ID NO:5.
[0032] Forward primer RWx-FG:
[0033] GAAGGTGACCAAGTTCATGCTTCATCAGGAAGAACATCTGCAAGG;
[0034] Forward primer RWx-FT:
[0035] GAAGGTCGGAGTCAACGG...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com