Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

HRM (High Resolution Melt) identification method, kit and primer group for muscovy duck parvovirus and goose parvovirus

A technology of Muscovy duck parvovirus and goose parvovirus, applied in the field of molecular biology, can solve the problems of increasing the cost of identification, operational complexity, time-consuming and laborious, etc., and achieve the goal of reducing identification cost, avoiding pollution, and high-throughput detection speed Effect

Active Publication Date: 2014-06-18
INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This undoubtedly increases the cost and operational complexity of identification
[0003] Although many domestic scholars have designed specific primers for MDPV and GPV genomes respectively, and established PCR detection technology for identifying MDPV and GPV, this method usually requires the design of two pairs of specific primers, and gel electrophoresis is required to determine the results , so this method will be time-consuming and labor-intensive when performing high-throughput detection tasks

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HRM (High Resolution Melt) identification method, kit and primer group for muscovy duck parvovirus and goose parvovirus
  • HRM (High Resolution Melt) identification method, kit and primer group for muscovy duck parvovirus and goose parvovirus
  • HRM (High Resolution Melt) identification method, kit and primer group for muscovy duck parvovirus and goose parvovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Establishment of the HRM Rapid Identification Kit for Muscovy Duck Parvovirus (MDPV) and Goose Parvovirus (GPV):

[0048] 1. Primer design: A pair of primers were designed with the VP3 genes of MDPV-FM and GPV-B (GenBank accession numbers U22967 and U25749, respectively) as the target genes. The sequences are as follows:

[0049] MGV-P1: ATGGCAGAGGGAGGAAGC (SEQ ID NO: 1);

[0050] MGV-P2: TGCGTCGTGACTTCTTTAACTTGC (SEQ ID NO: 2).

[0051] 2. PCR reaction solution: Taq DNA polymerase; 5×PCR reaction buffer; 2.5 mM dNTP; fluorescent saturating dye;

[0052] 3. The positive control is the positive plasmid of MDPV and GPV, and the negative control is ddH 2 O.

[0053] Wherein the preparation method of the positive plasmid is as follows ：

[0054] The VP3 gene (SEQ ID NO:3) of MDPV and the VP3 gene (SEQ ID NO:4) of GPV were respectively connected to the pMD-18T vector with the kit of TaKaRa Company, and the positive clones were screened by ampicillin screenin...

Embodiment 2

[0055] Example 2 Establishment of HRM Rapid Identification Method for Muscovy Duck Parvovirus (MDPV) and Goose Parvovirus (GPV)

[0056] The method for rapidly identifying Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) using the kit of Example 1 comprises the following steps:

[0057] 1. The positive plasmids of MDPV and GPV prepared in Example 1 were tested for DNA concentration, so that the initial template concentration of PCR was relatively consistent.

[0058] 2. PCR amplification reaction

[0059](1) PCR reaction system: 5×Q5 Reaction buffer 2μl, 2.5 mM dNTP 0.8μl, MGV-P1 (10μM) 0.5μl, MGV-P1 (10μM) 0.5μl, Q5 High-Fidelity DNA Polymerase 0.1μl, plasmid DNA 0.5 μl, LC Green 0.5μl, make up to 10μl with ultrapure water; mix the prepared reaction tube, centrifuge and put it on the machine.

[0060] (2) The PCR reaction procedure is as follows:

[0061] Pre-denaturation at 98°C for 30s;

[0062] Denaturation at 98°C for 10s, annealing at 55°C for 20s, extensi...

Embodiment 3

[0067] Example 3 Application Evaluation of HRM Rapid Identification Method for Muscovy Duck Parvovirus (MDPV) and Goose Parvovirus (GPV)

[0068] 1. Extraction of genomic DNA from the sample to be tested: use the kit MiniBEST Viral RNA / DNA Extraction Kit Ver.4.0 to extract the genomic DNA of MDPV and GPV in the sample. The samples of the present invention are virus allantoic fluid and cell supernatant.

[0069] 2. Ordinary PCR amplification reaction:

[0070] (1) PCR reaction system: 25 μl Reaction system: 5×Q5 Reaction buffer 5 μl, 2.5 mM dNTP 2 μl, MGV-P1 (10 μM) 1.25 μl, MGV-P1 (10 μM) 1.25 μl, Q5 High-Fidelity DNA Polymerase 0.25 μl, 1 μl of the sample DNA to be tested was made up to 25 μl with ultrapure water; the prepared reaction tube was mixed and centrifuged before loading on the machine.

[0071] (2) PCR reaction procedure:

[0072] Pre-denaturation at 98°C for 30s;

[0073] Denaturation at 98°C for 10s, annealing at 55°C for 20s, extension at 72°C for 20s; cyc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an HRM identification method, a kit and a primer group for muscovy duck parvovirus (MDPV) and goose parvovirus (GPV). A test method comprises the following steps: (1) designing a group of universal PCR primers capable of being used for simultaneously augmenting the muscovy duck parvovirus and the goose parvovirus; (2) extracting DNA (Deoxyribonucleic Acid) of a viral genome from a to-be-tested sample as template DNA; (3) treating the template DNA through a PCR (Polymerase Chain Reaction) amplification process by use of the primer group mentioned in the step (1); (4) treating an amplification product through HRM analysis, and identifying the MDPV and the GPV. The method disclosed by the invention can be used for rapidly and effectively identifying the MDPV and the GPV; high test speed and high throughput are achieved; the test of a PCR product of a 96 / 384 pore plate can be finished within 5-10 minutes, so that the test time is greatly shortened; no injury is caused to the PCR product, and subsequent analysis, such as sequencing and gel electrophoresis, can be implemented after the test.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to an HRM identification method, an identification kit and a primer set for Muscovy Duck Parvovirus (MDPV) and Goose Parvovirus (GPV). Background technique [0002] Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) are two waterfowl viruses. The physical and chemical properties and morphological structures of MDPV and GPV virus particles are very similar, so it is difficult to distinguish the two viruses through microscopic observation. The homology of its genome reaches 81.9%, the amino acid homology reaches 88.96%, and the homology of the structural protein VP1 reaches 87.57%, which determines their high degree of homology in antigenicity, but also There is cross-protection between the antisera of these two viruses. Therefore, in conventional serological detection methods such as latex agglutination test, agar diffusion test, fluorescent antibody te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/686C12Q1/70C12Q2531/113C12Q2527/107
Inventor 郭鹏举董嘉文张建峰陈琴苓嘎利兵嘎孙敏华李林林
Owner INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com