Product
Patsnap Eureka
For R&D, Patsnap Eureka makes reading and utilizing patents & technical documents easy.
Patsnap Eureka AIR
Designed for self-driven R&D workflows. Generate viable solutions, solve complex R&D challenges, empower your innovation with AI.
Patsnap Eureka Materials
Designed for material experts only. Revolutionize your material R&D, from search, analyze, to developing new materials.
Feature
TechResearch
Generate reliable direction feasibility study reports for your R&D in just a few steps.
TechSeek
Discover and master advanced knowledge NOW. Basics, ideas, possibilities, all at once.
TechMind
As an expert in R&D Theories, TechMind can generates customized viable solutions instantly.
TechRisk
Analyze your overall solution with one click, know your potential R&D risks in advance.
TechMonitor
Get weekly tech updates, stay abreast of the latest tech innovations and key insights.
Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
102 results about "Jungle" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
A jungle is land covered with dense vegetation dominated by trees. Application of the term has varied greatly during the past recent centuries. Before the 1970s, tropical rainforests were generally referred to as jungles but this terminology has fallen out of usage. Jungles in Western literature can represent a less civilised or unruly space outside the control of civilisation, attributed to the jungle's association in colonial discourse with places colonised by Europeans.
Aqueous polyurethane dispersoid for synthetic leather adhesive and preparation method thereof
ActiveCN104031225AHigh solid contentHigh peel strengthPolyureas/polyurethane adhesivesTextiles and paperPolyesterSide chain
The invention discloses an aqueous polyurethane dispersoid for a synthetic leather adhesive and a preparation method thereof. The aqueous polyurethane dispersoid is prepared from A, a polyurethane prepolymer prepared from 10-30wt% of polyisocyanate, 50-85wt% of polyester polyol, 0.1-3wt% of polyoxyalkylene side chain-containing dihydric alcohol, 0.1-5wt% of a low-molecular weight dihydric alcohol chain extender and 0.1-3wt% of hydroxy carboxylic acid, B, 0.1-5wt% of a polyamine chain extender a unsubstituted by an ion group, C, 0-5wt% of a chain extender b substituted by an ion group, and D, 66-100wt% of water. The aqueous polyurethane dispersoid has solid content of 50-60wt%. The synthetic leather adhesive prepared from the aqueous polyurethane dispersoid has good initial adhesion, high peel strength, excellent alkali, solvent and hydrolysis jungle test resistance, and soft handle.
Owner:WANHUA CHEM GRP CO LTD +1
Fire fighting system and method for fires in jungles, refineries and oil pipelines
InactiveUS8820421B2Efficient fire extinguishing elementQuick refillAircraft componentsFire rescueAir conditioningJungle
The various embodiments herein provide a system and method for fire extinguishing in forests. The fire extinguishing system herein includes a first storage tank, a second storage tank, a first fire extinguishing element, a second fire extinguishing element, a cover provided on top side of the first storage tank, a compressed air inlet, an air regulator, one or more hosing hasps, one or more tarpaulin hoses, one or more hooks, one or more clips and locks, a nozzle attached to a bottom side of the tank and a pipe to lead compressed air to nozzle. In the first stage the helicopter carries the sand tank from the station / depot to the firing woods and starts bombarding the sand around and top of the fire and a second helicopter carries the water tank from the station to the top of the bombarded flames and starts spraying water before the flame starts again.
Owner:RAHGOZAR NASER
Method for breeding snowy region jungle fowl
The invention relates to a method for breeding snowy region jungle fowl. The method comprises the steps of: selecting healthy and high-yielding eggs of snowy region jungle fowl, adopting chameleon solution to fumigate the selected eggs and placing the eggs on egg plates under certain temperature and humidity conditions; placing the eggs in a breeding room, arranging egg plates and carrying out breeding after natural pre-heating; respectively controlling space temperature and humidity of breeding machines according to different breeding periods; ensuring regular egg-turning and plate-adjusting to lead all the parts of embryo to be heated equally; selecting shell less eggs and dead eggs during two-time of egg-illumination so as to ensure that the live and healthy embryonated eggs can obtain hatchability from the 20th day of the breeding period, and placing the embryonated eggs to rearing rooms or boxes for nursing. The method comprises the processes of selection, sterilization, humidification, heating, egg-turning, illumination and the like to breed the snowy region jungle fowl meeting green and organic standards, and the hatchability reaches 87 to 91 percent.
Owner:SHANGHAI JIAO TONG UNIV
Fire fighting system and method for fires in jungles, refineries and oil pipelines
InactiveUS20100263886A1Efficient fire extinguishing elementQuick refillAircraft componentsFire rescueFire fighterAir conditioning
The various embodiments herein provide a system and method for fire extinguishing in forests. The fire extinguishing system herein includes a first storage tank, a second storage tank, a first fire extinguishing element, a second fire extinguishing element, a cover provided on top side of the first storage tank, a compressed air inlet, an air regulator, one or more hosing hasps, one or more tarpaulin hoses, one or more hooks, one or more clips and locks, a nozzle attached to a bottom side of the tank and a pipe to lead compressed air to nozzle. In the first stage the helicopter carries the sand tank from the station / depot to the firing woods and starts bombarding the sand around and top of the fire and a second helicopter carries the water tank from the station to the top of the bombarded flames and starts spraying water before the flame starts again.
Owner:RAHGOZAR NASER
Household Jungle Gym
InactiveUS20120157266A1Compact storageEasy to operateGymnastic climbingSwingsEngineeringMechanical engineering
There is provided a household jungle gym 10 including a swing space 200 which is formed continuously with a lateral side of a frame structure 100, a swing supporting shaft 21 which is detachably stretched in the swing space 200, a triangular supporting portion 40 which pivotally supports the swing supporting shaft 21, strut pipes 41 which support the triangular supporting portion 40, and two telescopic pipes 30 which are disposed parallel to each other on a floor surface and which each have a double rod construction so as to be telescopic, wherein when the jungle gym 10 is stowed, by dismounting the swing 20 and the swing supporting shaft 21 and causing the two telescopic pipes 30 to slide, the triangular supporting portion 40 and the strut pipes 41 can be moved extremely close to the frame structure 100.
Owner:AGATSUMA CO LTD
Method for realizing scale-raising of snowy region jungle fowl
InactiveCN101574071AImplement separate feedingKeep meat flavorFood processingAnimal feeding stuffDiseaseTerrain
The invention discloses a method for realizing scale-raising of snowy region jungle fowl. The method comprises the steps of: dividing raising process into nursing period, transition period and stocking period according to growth characteristic of the snowy region jungle fowl and adopting different raising manners respectively; keeping the snowy region jungle fowl in henhouses during the nursing period; gradually feeding grass and original animal protein to the snowy region jungle fowl as the increase of age in days, adopting self-help feeding and also increasing ventilation quantity with the outdoor during the transition period; starting stocking when the outdoor temperature is similar to the indoor temperature, and choosing high and dry forest grass grounds with better ventilation as stocking grounds, constructing fences and also constructing simple barns in the fences, adopting the method of combining grazing with supplementary feeding in the fences, and adopting nuisanceless green feedstuff without antibiotics and hormone as the feedstuff of the snowy region jungle fowl in the stocking period. The self-help feeding and free movement of the stocking period of the snowy region jungle fowl can save partial feedstuff and reduce raising cost and also can effectively prevent diseases and preserve chicken quality and flavor of the snowy region jungle fowl, so as to realize the green scale-raising.
Owner:SHANGHAI JIAO TONG UNIV
Jungle gym
Owner:TOMY CO LTD
Jungle jumparoo systems
InactiveUS9033853B1Increase safety enjoymentMaximize structural rigidityGymnastic climbingFreely-suspended gymnasticsMetal frameworkEngineering
A pneumatic tube jumping structure system to increase the safety and enjoyment of jumping and other physical activities. The pneumatic tube jumping structure employs a metal frame to support a pneumatic tube upon which a single user or multiple users may jump, bounce, or otherwise play. The frame provides safety handrails that serve dual purposes: ensuring the safety of a user; and aiding a user in jumping and otherwise making use of the pneumatic tube jumping structure system. The frame also allows for the connection of an activity attachment, such as a rope swing, for the enjoyment of a user, making the structure a multi-purpose amusement and exercise device.
Owner:MCMURTREY STEPHEN
Ultra-thin layered wax film antirust composition for firearm
The fire-arm ultrafine waxed-film anti-rust compound as weapon protective material comprises the wax film-forming material, the PTFE lubricating agent, the oil-soluble inhibitor and organic solvent, can form 2-5mu waxed film rapidly with well lubrication, has no greasiness, drain, and resistance to scratch and wet-heat, fit to shoot with oil and thereby meet the protective requests in exacting terms in desert, jungle and underwater, simplifies maintenance practices for weapon equipment to advance army response speed to burst accident, and can also fit to domestic use.
Owner:ORDNANCE TECH RES INST OF THE GENERAL ARMAMENT DEPT PLA
Sex appraisal process for pigeon for meat
InactiveCN101333563AReduce harmConducive to breeding programsMicrobiological testing/measurementStainingExon
Disclosed is a method for identifying the sex of meat pigeons, which belongs to the molecular biology technique field. Through comparing exon sequences at both ends of introns of CHD genes of jungle fowls and cygnets, exons on two ends thereof are respectively designed with an upstream primer and a downstream primer: Psf: 5`CAAGGATGAGAAACTGTGCAA3`; and Psr: 5`GAATATCTTCTGCTCCTACTG3`; and the Psf / Psr primers are used for amplifying the CHD genes on Z and W chromosomes of meat pigeon feather pulp genome DNA, and finally the sex is identified according to the band type through 10 percent polyacrylamide gel electrophoresis and silver staining, wherein, female shows two bands and male shows one band. The method can identify the sex of birds by only mastering the general PCR technique and polyacrylamide gel electrophoresis and silver staining operations, and has advantages of strong repeatability and high accuracy (100 percent, n=280).
Owner:YANGZHOU UNIV
Jungle gym
InactiveUS9868008B2Reduce thicknessEasy to storeGymnastic climbingRod connectionsTarsal JointMechanical engineering
A jungle gym is provided which has a base frame group where three cubic frames are formed continuously in a y axis direction by pluralities of pipes provided in an x, y and z axis directions, and a plurality of jungle gym joints each including a joint main body and a rotary member and where the rotary member is connected rotatably to the joint main body so as to form a folding portion which can be folded in one direction within an angular extent of 90 degrees, and the pipes in the y and z axis directions are connected to the joint main bodies, while the pipes in the x axis direction are connected to end portions of the rotary members lying opposite to end portions where the folding portions are formed, all the folding portions being rotated in the same direction.
Owner:AGATSUMA CO LTD
Air negative pressure differential tool bit leaf harvester
The invention discloses an air negative pressure differential tool bit leaf harvester. The harvester comprises a tubular nose, a collecting tank, a negative pressure machine, corrugated pipelines, a support pipe and a trolley. The leaf harvester adopts air negative pressure transmission driving and the differential rotation of multi-group cutting blades of the tubular nose is realized, thereby repeatedly cutting leaves to obtain small leaf fragments. The cut leaf fragments are collected and processed. The harvester can be used for harvesting leaves and tender branches and buds of broussonetia papyrifera in a large space range, also can be widely applied to pruning of jungles and shrubs in the field of landscaping, and integrates harvesting, pruning and collecting and processing, so that the labor intensity is greatly reduced, and the working efficiency is improved.
Owner:HUBEI UNIV OF TECH
Jungle gym
A jungle gym requiring a small storage space and easy assembly is provided. A jungle gym comprises a main frame body comprising connecting bars extending vertically or horizontally. The main frame body has a shape of an approximate cube or an approximate rectangular parallelepiped as a whole by connecting the connecting bars. The jungle gym also has a sub-frame body being attached to the main frame body and turnable around one of connecting bars of the main frame body or around an axis being parallel to the one of connecting bars. The sub-frame body is capable of folding along the main frame body.
Owner:TOMY CO LTD
Method for feeding low-fat multivitamin chicken
The invention discloses a method for feeding low-fat multivitamin chicken, which comprises the following steps: a, controlling the feeding amount so as to meet the needs for the chicken growth; b, regularly adopting jungle stocking so that the chicken can find food such as insects and grass; and c, increasing the feeding time so that the growth period of 60-68 days is increased to a growth period of 170-180 days. By adopting the method, the feeding amount is controlled to be determined according to the growth period of chicken, and the feeding time is increased; and trace elements are not added to the feed formula. By proportioning feed and vegetable, the chicken obtains nutrient components for growth through the vegetable. Due to the regular free-range feeding, the chicken can obtain food such as insects, grass and the like from nature. Fish meal in the feed is prepared from freshwater fish instead of seawater fish which causes relatively strong fishy smell of eggs, the eating effect of eggs is improved, and trace elements in a human body can be supplemented after long-term use of the low-fat multivitamin chicken.
Owner:张文水
Intelligent jungle canopy surveillance apparatus and method
Jungle canopy surveillance apparatus and method for surveillance of human presence in a jungle canopy environment includes a plurality of sensor-relay units configured to be disposed on or near the jungle floor, and configured to detect human presence and wirelessly transmit a corresponding detection signal. At least one of the sensor-relay units is configured to receive a detection signal from another sensor-relay unit and to relay the thus-received detection signal. An artificial intelligence center is configured to be disposed on or near the top of the jungle canopy, and is configured to (i) receive at least one of the detection signal and the relayed detection signal, (ii) analyze the received at least one of the detection signal and the relayed detection signal using artificial intelligence software, and (iii) transmit a corresponding report signal to a receiving platform.
Owner:WELLER CHRISTOPHER WILLIAM +1
Preparation method for high-conductivity electromagnetic shielding rubber with electrochemical corrosion resistance
The invention relates to a preparation method for high-conductivity electromagnetic shielding rubber with electrochemical corrosion resistance and belongs to the technical field of a conductive composite. In a nickel-coated aluminum powder / silicon rubber composite prepared according to the invention, the nickel-coated aluminum powder has the advantages of high electrical conductivity, low cost and excellent oxidation resistance. The rubber composite prepared according to the method has high electrical conductivity and high conductivity stability and has higher electromagnetic shielding effect and better electrochemical corrosion resistance. The preparation method is simple and feasible, is low in cost, is easy for industrialization, is suitable for the electromagnetic shielding protection in damp corrosion environments, such as, ships and unmanned stations in jungles, and has better national defense and safety significance and economic benefits.
Owner:BEIJING UNIV OF CHEM TECH
Jungle gym
InactiveUS20160250508A1Reduce thicknessEasy to storeGymnastic climbingRod connectionsEngineeringSacroiliac joint
A jungle gym is provided which has a base frame group where three cubic frames are formed continuously in a y axis direction by pluralities of pipes provided in an x, y and z axis directions, and a plurality of jungle gym joints each including a joint main body and a rotary member and where the rotary member is connected rotatably to the joint main body so as to form a folding portion which can be folded in one direction within an angular extent of 90 degrees, and the pipes in the y and z axis directions are connected to the joint main bodies, while the pipes in the x axis direction are connected to end portions of the rotary members lying opposite to end portions where the folding portions are formed, all the folding portions being rotated in the same direction.
Owner:AGATSUMA CO LTD
Method of harvesting timber trees in a jungle and a machine for performing said method
InactiveUS6564835B1Avoid damageReduce obstructionMulti-purpose machinesForestryForest harvestingWinch
Owner:GREEN EARTH LTD
Segmented observable activity enclosure and method of use
An activity enclosure and method of use thereof, the enclosure having a play area with a centrally located portion for parental observation of children at play. The enclosure has benches and barbecue grills, and radially-extending play segments that selectively include basketball, croquet, miniature golf, golf pool, paddleball, a sandpit, a Jungle Gym, and so forth. The central portion is covered to protect from the elements. The entire play area is fenced in and may comprise a variety of overall shapes (square, rectangle circle, etc.) with a central portion having radial play segments emanating therefrom. Game equipment with identifying names is provided to new home purchasers for utilizing on the play areas.
Owner:MCKEY ROBERT W
Device for trimming branches in garden
InactiveCN108496605AIncrease the lengthEasy to trimCuttersCutting implementsVegetationElectric machinery
The invention relates to a device for trimming branches in a garden, and relates to the field of garden equipment, in particular to a device for trimming branches in a garden. The device comprises a telescopic mechanism, a folding mechanism and a trimming mechanism, wherein the telescopic mechanism comprises a telescopic assembly and a power assembly which is used for driving the telescopic assembly to work, the telescopic assembly is connected with the power assembly in a transmission mode, and the telescopic assembly includes a first connecting rod and a second connecting rod; a storing groove which is used for storing the second connecting rod is formed in the middle of the first connecting rod, protruding arris are arranged on both sides of the second connecting rod, and a sliding groove which is slidably matched with the protruding arris is formed in the side part of the storing groove; one side of the second connecting rod is provided with a gear rack which is fixedly connected to the second connecting rod, and the trimming mechanism includes a trimming assembly and a driving assembly. The device for trimming the branches has the advantages that through the device, the lengthof the whole device can be extended multiple times, trimming of vegetation in a jungle and vegetation of a large height by a worker can be facilitated, and by using a driving motor to drive the trimming mechanism to perform trimming, operation and use of the worker is facilitated.
Owner:段沛荣
Amphibious-warfare boots
The invention relates to the technical field of military clothes, in particular to amphibious-warfare boots. Each land-warfare boot comprises a boot body and a web water piece which is arranged on the front portion of the boot body, and each boot body and the corresponding web water piece are detachably connected. According to the land-warfare boots, each boot body and the corresponding web water piece are detachably connected, when only the boot bodies are used, the boots can be used as land-warfare boots, but the weight of each land-warfare boot is only a half of that of the existing amphibious-warfare boot, and when wearing the land-warfare boots, a soldier can march forward in a jungle or on various different types of terrain conveniently and rapidly. When the solider needs to swim in battle gears and fight in water, each web water piece can be installed on the front portion of the corresponding boot body rapidly, the soldier can shift from the land warfare state to the water warfare state rapidly, meanwhile, the soldier can complete landing without taking off or changing the boots during beaching, the assault speed is raised, the military operation time and rescue time are won, the boots can be used for amphibious purpose, and the boots are convenient to install and dismount.
Owner:周道裕
Forest fire-fighting launching system powered by pulse pressure
InactiveCN103706059AEasy to carry and transportEasy to useFire rescueEngineeringAtmospheric pressure
The invention belongs to the field of fire-fighting equipment, and provides a forest fire-fighting launching system powered by pulse pressure. The forest fire-fighting launching system is launched by using the pulse pressure as a power, relieves machinery insurance by the launching pressure, starts a delay detonating device to work, and can carry out remote save and suppression for fire scenes that are difficult for people to get close to. A high-pressure cylinder is in a single backpack type; and the interface is universally applied with that of a firemen breathing high-pressure cylinder. The whole system is convenient for transporting and carrying in jungles and other complex environments, is convenient for use and short in launching preparation time and can be used without being restricted by fields. Firefighters can implement the system rapidly and flexibly according firing line changes of forest fire. The system can be launched without gunpowder and is good in operation security.
Owner:山西北方晋东化工有限公司
Jungle gym joint and jungle gym
A jungle gym joint has a joint main body including joint shafts to which pipes are connected and rotary members. The pipe is connected to one end and a folding portion is formed at the other end of the rotary member, the folding member being formed by a flat plate portion being held in a bifurcate portion together with the joint main body. A cover member including engaging projections on an inner circumferential surface is provided on an outer circumference of the folding portion. The cover member is guided to move back and forth in an axial direction by the engaging projections being brought into engagement with guide grooves. The folding portion is restricted from being folded with the cover member staying in an advanced end position while the restriction of folding thereof can be released with the cover member staying in a withdrawal end position.
Owner:AGATSUMA CO LTD
Pseudosasa amabilis summer planting method
ActiveCN105325142APlay a supporting rolePromote rootingPlant cultivationCultivating equipmentsEvaporationCataphyll
The invention provides a pseudosasa amabilis summer planting method comprising the following steps: selecting strong plants with multi-whip segment, and removing weak plants in a bamboo jungle; removing twigs for the selected pseudosasa amabilis, removing blades for pseudosasa amabilis with dense branches and leaves, thus reducing mass moisture evaporation in transplanting the pseudosasa amabilis; applying sufficient base fertilizers in planting pits, stirring the fertilizer with surface soils in the pit and water so as to form slurry, thus supporting the pseudosasa amabilis in certain level, promoting pseudosasa amabilis rooting, and improving pseudosasa amabilis survival rate; in a pseudosasa amabilis management period, regularly moisturizing the whole plant of the pseudosasa amabilis, timely shading the plants, and binding adjacent 3-4 plants in each pit by straws, thus preventing storm and rainstorm from affecting the pseudosasa amabilis survival. The pseudosasa amabilis summer planting method can enable the pseudosasa amabilis survival rate to be above 90% in summer plantation, thus providing higher economic, social and ecological benefits.
Owner:湖南省森林植物园
Impact-prevention cargo unmanned aerial vehicle set according to jungle birds
InactiveCN109911222AReduce the speed of the fallProtection securityParachutesAircraft indicatorsCircular discPropeller
The invention discloses an impact-prevention cargo unmanned aerial vehicle set according to jungle birds, structurally comprising an impact prevention measure structure, a propeller, a unmanned aerialvehicle body, a cargo body and a support bracket, wherein the support bracket is fixed to the lower side of the unmanned aerial vehicle body; the cargo body is embedded in the interior of the supportbracket, and the impact prevention measure structure is provided with an emergency force landing structure, a tension moving and distracting structure, a sensing start triggering structure and an internal working chamber. The beneficial effects are as follows: through the impact prevention measure structure, when the unmanned aerial vehicle body accidentally hits a sparrow hawk in the jungle, a steel ball disc is driven through the operation of the internal working chamber, so that the restriction on the emergency force landing structure by beveled cover rods at the two sides is released under the driving of pull-down rigid rope connecting balls. Through the impact prevention measure structure, the safety of the unmanned aerial vehicle and the cargo when the unmanned aerial vehicle has anaccidental fall event can be protected.
Owner:苏顺财
Chinese herbal medicine compound agent for raising snowy region jungle fowl
InactiveCN101579060ASolve residual problemsHeat-clearing and detoxifyingAnimal feeding stuffDiseaseFowl
The invention relates to a Chinese herbal medicine compound agent for raising a snowy region jungle fowl. Aiming at the characteristic of snowy region jungle fowl, Chinese herbal medicines of aloe, rhizoma coptidis, phellodendron, hyacinth bean, dandelion, Chinese violet, fructus kochiae, ballonflower, notoginseng, white paeony root, fructus mume, cassia nomame and dyers woad leaf are adopted to prepare the Chinese herbal medicine compound agent. Corresponding dosage is adopted for raising the jungle fowl according to different snowy region jungle fowl ages, so as to prevent and treat disease, promote the snowy region jungle fowl to grow healthily and avoid side effects produced by chemical drugs on the jungle fowl. From the birth date, the jungle fowl can be raised with the compound agent, the action of clearing away heat and toxic material and antibacterial and inflammation diminishing can be realized, thus the residue problem of chemical drugs of dorking product is solved and economic benefit is obviously improved.
Owner:SHANGHAI JIAO TONG UNIV
Small PTZ camera based on jungle distribution area
PendingCN109981931AImprove maintainabilityReduced risk of breakageTelevision system detailsColor television detailsMaintainabilityAngular degrees
The invention belongs to a camera, and particularly relates to a small PTZ camera based on a jungle distribution area. The small PTZ camera based on a jungle distribution area comprises a pitching assembly and a rotating assembly, the pitching assembly is arranged at the front end of the rotating assembly, the rotating assembly can drive the pitching assembly to rotate along a connecting shaft, acamera is arranged in the pitching assembly, and the camera can be driven by the pitching assembly to rotate at a pitching angle. The beneficial effects of the invention are that: (1) the rotation range is greatly improved, and the risk of cable breakage caused by motor explosion is reduced; even if the motor runs out, the maintainability of the pitching assembly is improved due to the use of thehigh-definition video sliding brush; (2) the triggering range is 1-1.5 mm, the sensitivity is + / -0.5 mm, and the pitching positioning precision is high; and (3) the SDI video format data can be transmitted stably at a high speed.
Owner:RES INST OF NUCLEAR POWER OPERATION +1
Jungle gym joint and jungle gym
Owner:AGATSUMA CO LTD
Novel range hood oil filtering net
InactiveCN104006433AEasy to condenseWell condensed so that the oil gas and the outer surface of the metal pipe fullyDomestic stoves or rangesLighting and heating apparatusEngineeringMechanical engineering
The invention discloses a novel range hood oil filtering net which is arranged at a fume sucking hole of a range hood or at any position from the fume sucking hole to a range hood volute air inlet. The oil filtering net comprises an outer frame, wherein an air guide channel is formed in an edge of the outer frame; the outer frame is internally provided with a plurality of hollow metal tubes which are communicated with the air guide channel; a plurality of vent holes are formed in another edge of the outer frame; the other ends of the hollow metal tubes are connected with the vent holes. As a jungle-type arrangement structure is adopted for the metal tubes, hot oily fume can be well condensed on the outer surfaces of the metal tubes and subsequently flows into an oil cup below the range hood along the walls of the metal tubes, so that the capacity of oily fume condensation is greatly improved, the air resistance is alleviated, and the noise is reduced.
Owner:VATTI CORP LTD
Wind energy rotary piezoelectric-electromagnetic composite power generation device
ActiveCN110112954AAvoid pollutionAvoid resourcesPiezoelectric/electrostriction/magnetostriction machinesMagnetic tension forceLow speed
The invention discloses a wind energy rotary piezoelectric-electromagnetic composite power generation device, and relates to the field of piezoelectric-electromagnetic composite power generation and the field of new energy utilization. By means of the magnetic force between the wind energy and a magnet in a low-speed wind field, the power generation device can use a piezoelectric sheet to producea positive piezoelectric effect, and uses a coil to cut magnetic induction lines and simultaneously output a voltage, thereby solving the low power generation efficiency and low energy utilization rate under the low-speed wind field. The power generation device mainly consists of fan blades, a transmission shaft, a ceramic piezoelectric sheet, magnets, a coil, a spring and an elastic support layer. Under the effect of the wind, the fan blades periodically changes the magnetic force between a movable magnet and a fixed magnet, and stimulates the ceramic piezoelectric sheet and the coil to continuously act. The power supply to low-energy equipment with clean energy (wind energy) can avoid environmental pollution, a waste of resources and the like. The power generation device can improve thepower supply quality of low-energy electronic products in harsh environments (jungles, valleys, hillsides and the like).
Owner:SHANDONG UNIV OF TECH
Popular searches
Who we serve
- R&D Engineer
- R&D Manager
- IP Professional
Why Patsnap Eureka
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com