78 results about "Pastoralism" patented technology

The present invention relates in general to the field of animal husbandry, and more specifically, to a livestock monitoring system utilizing an unmanned aerial vehicle (“UAV”) and methods of using such systems. The system and method of the present invention for monitoring the health and welfare of livestock comprises six primary components: (1) at least one UAV; (2) a plurality of cameras and sensors; (3) a transmitter; (4) a receiver; (5) a server connected to a computer system for receiving images, video, and data from the plurality of cameras and sensors; and (6) a display for viewing in real-time images, video and data obtained from the plurality of cameras and sensors for monitoring the condition of livestock on a farm or ranch. The purpose of the invention is to provide a convenient and cost-efficient system and method for monitoring the condition of livestock to obtain information in real-time about the behavioral and physiological states of individual animals.

The use of macroalgal, microalgal, and fungally-derived materials provide, in combination with higher-plant derived materials, complete feeds for animal husbandry. The products and methods of the invention provide nutritional feed formulations, that reduce or eliminate the need for animal-derived materials. The feeds are useful for terrestrial or aquatic animals, and comprise docosahexaenoic acid and eicosapentaenoic acid.

The invention relates to a method for mixedly sowing annual ryegrass and perennial grass, which is suitable for establishing artificial grassland in south, in particular to a method for establishing artificial grassland by introducing annual ryegrass onto perennial artificial grassland. The annual ryegrass and the perennial grass are mixedly sowed by a certain proportion. By utilizing the advantages of rapidly growing of the annual ryegrass, the cutting is performed at the right time, the grass yield in season is improved, and the height can be controlled by cutting. Therefore, the growth of the perennial grass can be ensured, the growth of the weeds is inhibited because of insufficient light, and then the weeds gradually disappear from the grass. The invention solves the problems of low grass yield of the artificial grassland established in the current year in south and heavy weeds, thereby being of great significance for popularizing artificial grassland growth in south and promoting the development of grassland agriculture in south.

The invention discloses a salmonella LAMP (loop-mediated isothermal amplification) detection method, and a special primer and kit thereof. The special primer is designed according to a salmonella specific conservative target sequence invA gene shown in sequence 1 in a sequence list, and is used for qualitatively detecting salmonella in a sample to be detected. The invention can realize the fast, convenient, efficient, specific and sensitive detection of salmonella under isothermal conditions without using complicated instruments, thereby providing a new technical platform for salmonella detection. The invention can be used for salmonella screening and detection in livestock farming and production units, grass-root medical health units and various disease prevention and control centers, has broad market prospects and great economic and social benefits, and is suitable for wide popularization and application.

The invention belongs to the technical field of breeding industry devices, and particularly relates to an energy-saving water dispenser for stock farming breeding. The energy-saving water dispenser comprises a water tank (1), a tank bottom (2), a water inlet (3) and a water outlet (4), wherein the water inlet (3) and the water outlet (4) are formed in the walls of the two ends of the water tank (1) respectively. The energy-saving water dispenser is characterized in that a far infrared heater (5) is arranged below the tank bottom (2), a heat preservation layer (6) is arranged below the far infrared heater (5), a controller (7) is placed on a supporting frame (8) arranged above the tank bottom (2), a rotating shaft (9) arranged on the supporting frame (8) is connected with a cover plate (10), and a temperature sensor (11) and a ball cock (12) are arranged in the water tank (1). Compared with a water dispenser currently used in a breeding farm, the energy-saving water dispenser is simple in structure, can conveniently heat water in the water tank (1), and is suitable for being massively popularized and used.

The invention belongs to the technical field of animal husbandry, and specifically relates to a method for the ecological captive breeding of goats. According to the method for the ecological captive breeding of goats, a pasture planting base and a sports ground are established, wherein the pasture planting base is used for planting high-yield and high-quality pastures which are used as the feed sources of the captive goats, and the sports ground is used as a sport field for the goats; furthermore, the goat manure and urine in goat pens are collected to make organic fertilizer which is used for the planting fertilization of the pastures; one third of the pasture planting base is used for planting perennial pastures; and two thirds of the pasture planting base is used as an annual pasture planting area which is used for the crop rotation of cold-season and warm-season pastures. According to the method provided by the invention, the obvious conflict of land scramble between the breeding industry and the mountain planting industry is effectively solved and the mountain economic crops are not damaged by the grazed goats any more, so that the safe production is realized, the orderly development of the whole large-scale agriculture is promoted, sustainable development is obtained and eco-friendly development is realized.

A truck for shredding and mixing products for zootechnical use, of the type that comprises, on a chassis (11) with wheels (12) that is self-propelled or towed, a container (13) that is substantially shaped like an inverted frustum, is open in an upper region and contains shredding and mixing means (14) which comprise at least two adjacent rotating main screw feeders (15, 16), each having an external profile (17) that lies on a substantially conical imaginary surface and at which shredding cutters are mounted. Contrast cutters (20) substantially shaped like circular sectors are hinged to the internal wall of the container (13) by means of their respective vertices in a vertical arrangement in substantially radial positions and can be inserted and removed through appropriately provided slots. Auxiliary screw feeders (18, 19), suitable to avoid the formation of stagnation regions, are arranged between the main screw feeders (15, 16), in the regions adjacent to the walls of the container (13).

The invention provides an intelligent livestock system based on the Internet of Things, relates to the field of application sensors, LoRa networks, and artificial intelligence livestock, realizes theautomatic collection of livestock and pasture statuses, stores and analyzes data, and gives an intelligent solution for integrating the Internet of Things technology into the livestock industry. The intelligent livestock system comprises an intelligent livestock software system, a special soil moisture information collection climatological station for a pasture, a livestock wearable device, a visual individual identification module and a livestock wireless network based on an LoRa broadband technology. The livestock personnel, scientific research institutions and regulatory agencies can masterthe conditions of the pasture and livestock in real time for daily management; the linkage between ranchers, experts and supervision departments is realized to provide solutions and rapid support foremergency events; complete livestock bookbuilding is achieved, and a foundation is built for further integrating pastures, slaughter houses and retailer information and realizing whole-course qualitytracing; and a large-range epidemic disease outbreak is predicted and effectively controlled by combining a think tank and a big data analysis technology.

The invention relates to a large-scale farm sign abnormal bird detection method, which comprises the following steps: pre-processing the collected thermographic images for data annotation, then adopting an instance-based segmentation general framework (Mask RCNN) target detection and instance separation method for feature extraction, pixel alignment, target positioning, classification and mask separation for thermal imaging images, by controlling the target detection number of a single image, improving the detection accuracy rate in each image. The method is an attempt in the field of target detection of current thermal imaging images, breaks the limitations brought by the traditional methods, and uses the superior performance of deep learning in image feature processing to improve the robustness and accuracy of a model. The feasibility of the deep learning method in the field of thermal imaging image detection is verified. At the same time, the method can also be extended to the livestock and other fields, thus improving the level of intelligence in the breeding industry in China.

The invention relates to a livestock farm sterilization device used for stock farming. The livestock farm sterilization device is novel in structure and high in working efficiency; and operation is simple. The livestock farm sterilization device comprises a base plate, a left support, a first sliding rail, first sliding blocks, a first toothed bar, a second toothed bar, a bearing pedestal, first supporting rods, a first toothed wheel, a rotating shaft, annular sliding rails, a connection plate, second sliding blocks, and a second supporting rod; the right side of the top part of the base plate is symmetrically provided with the first supporting rods ; and the top end of each first supporting rod is provided with one of the annular sliding rails. The structure is novel; operation is simple; working efficiency is high; the livestock farm sterilization device can be used for spraying sanitizers uniformly in livestock farms, high efficiency sterilization is realized, and a travel switch is capable of simplifying device operation.

The invention mainly relates to a method for identifying authenticity of a medicago sativa seed and special primers thereof, in particular to a gene detection kit of medicago sativa and melilotus albus and a detection method thereof. The kit for identifying the authenticity of the medicago sativa seed is mainly characterized in that: the total volume of a medicago sativa PCR (Polymerase Chain Reaction) detection system is 20 mul; and the kit comprises 2*PCR Master, the special primer MsITS-F (5'-3'): TTTTTGAACGCAAGTTGCGC and the special primer MsITS-R (5'-3'): CAACCAACCACGAGACAGA and ddH2O. Detection result shows that the technology can be used for identifying the authenticity of the medicago sativa seed, has the characteristics of high sensitivity, high accuracy, high repeatability, quickness, convenience and the like, has broad application prospect in medicago sativa industrial promotion of China, can guarantee that the production of livestock husbandry of China is served by the medicago sativa well and lays a solid foundation for guaranteeing grain safety of China.

The present invention discloses an artificial method for breeding seeds of the Tibetan wild Baqing lyme grass; with the method, people collect the seeds of the wild Baqing lyme grass and break the dormancy of seeds; people choose the sowing soil for fertilizing, irrigation, spraying plant growing regulator and implement artificial auxiliary pollination until the field management after the seeds are harvested; the method solves the existent problem of artificial breeding of wild Baqing lyme grass seeds; with the method, the production and quality of the seeds of Baqing lyme grass can be promoted and the Baqing lyme grass can be further utilized in the plant restoration in degenerated pasture, ecological construction and pasture stockbreeding production on the Qinghai and Tibet plateau.

The invention relates to a technology for preparing feed of flocks and herds by taking sugarcane tops or bagasse as raw material. The technology comprises the following steps: cutting the sugarcane tops into fragments with the length of 5cm-6cm; performing primary drying on the sugarcane top fragments in a dryer at the temperature of 250-300 DEG C for 120-180 seconds till the humidity is 22%-25%; spraying cane molasses, and drying the fragments in a secondary hot air dryer at the temperature of 60-70 DEG C for 100-130 seconds till the humidity is 15%-18%; and smashing the sugarcane top fragments and the cane molasses, and mixing the smashed material with other raw materials, pelletizing, and then packaging to obtain the finished feed product. The technology can be used for realizing comprehensive utilization of rich sugarcane byproduct resources in the local area to produce the feed supplying sufficient nutrients for growing flocks and herds, and also can relieve the contradiction between a straw biological pellet feed and increasingly developing stock farming, reduce feeding cost and improve economic benefit.

The present invention belongs to the technical field of ecological cultivation, and especially relates to a forest, goose and fish stereo ecological cultivation method. The stereo ecological cultivation method mainly comprises (1) land addressing requirement, (2) partition layout design, (3) cultivation density arrangement, and (4) cultivation operation and the like. According to the stereo ecological cultivation method, through organic combination, scientific collocation and advantage complementation of the planting industry, animal husbandry and aquaculture industry, nutrient substance is metabolized to cultivation waste water along with a chain of forest ( and supplementary feeding fodder), goose, goose manure, fish (and forest) and pond water layer by layer, egg goose cultivation period is shorted, goose egg quality is improved, good natural ecological circulation is achieved, land use efficiency is also improved, the purpose of pollutants discharge reduction is achieved, economic benefit is largely increased, the advantage of forest, goose and fish stereo cultivation is comprehensively embodied, and the whole industry chain is improved.

The invention discloses a method for interplanting clovers in sugarcane fields to realize high-efficient utilization of sugarcane field resources, make full use of space, save land cost and increase economic benefit per unit field area. Clovers and sugarcanes require different soil nutrients, which realizes nutrient complementation between clovers and sugarcanes. Clovers are leguminosae plants, fix nitrogen and provide sugarcanes with sufficient nutrients. In this way, fertilizer used can be reduced, cost is lowered, and chemical pollution is reduced. The sugarcanes provide shade for clovers, which allows clovers to better grow in southern China with strong sunlight. Excellent food source can be provided to stock farming in southern China.

The invention discloses a method for intercropping baby cabbage and forage grass oat. In particular, a baby cabbage and forage grass oat intercropping mode is adopted, so that field weeds growing at the seedling stage of baby cabbage can be restrained effectively, field closure of baby cabbage is reduced, the utilization ratios of the resources of light, temperature, water and soil are increased, and the yield of forage grass is increased. The method comprises the following steps: controlling inter-row weeds of the baby cabbage at the seedling stage of the baby cabbage by adopting forage grass oat, and preserving soil and water; selecting an upright forage grass oat variety having the characteristics of cutting resistance, high reproducibility and large leaf amount, cutting in time at the vegetative growth phase of oat, and controlling the stubble height to ensure regeneration of oat in order to avoid field closure of baby cabbage; harvesting the baby cabbage, scattering residual stems and leaves onto baby cabbage lines to realize straw turnover; after harvesting baby cabbage, applying urea in time to promote the growth of he oat, wherein the residual fertility of the baby cabbage lines can be effectively utilized by oat. By adopting the method, the problem of diseases of the baby cabbage caused by abnormal temperature in winter can be relieved, the spare seasons after the harvest of vegetables are effectively utilized, the popularization of the oat in winter fallow farmlands in southern areas is promoted, and forage grass supply in winter and spring in the herbivorous livestock in southern areas is ensured.

The invention relates to a cowshed cooling device and in particular relates to a cowshed cooling device for stock farming. The cowshed cooling device can quickly cool, shield sunlight and promote air circulation. The cowshed cooling device comprises a cowshed, a cylinder body, a water tank, a water inlet pipe, a first one-way valve, a piston, a push rod, a first motor, a connection rod, a cam, a movable plate, a first spring and a ventilating window, wherein the cowshed and the cylinder body are fixed on the ground; the cylinder body is arranged on the right of the cowshed; the water tank is installed on the ground and under the right-lower side of the cylinder body; the water inlet pipe is arranged between the right lower part of the water tank and the left lower part of the cylinder body; the first one-way valve is disposed in the water inlet pipe; the piston is disposed in the cylinder body; and a push rod is vertically arranged on the top of the piston. Effects of quick cooling, sunlight shield and air circulation can be achieved by the use of the cowshed cooling device.

The invention relates to a multi-function mosquito and fly-catching lamp for livestock farms, and in particular relates to the technical field of mosquito eradication equipment of livestock husbandry. A handle (1) is buckled at the upper end of a top cap (2), and the lower end of the top cap (2) is provided with a mosquito-fly entering rack (9). The lower end of the mosquito-fly entering rack (9) is provided with a mosquito-fly collecting bucket (14), and the port of the mosquito-fly collecting bucket (14) is sheathed with a mosquito-fly sucking funnel (12). The lower end of the mosquito-fly sucking funnel (12) is provided with a pair of one-way door (13), and the bottom of the mosquito-fly collecting bucket (14) is provided with a suction fan (18). The outer side of the mosquito-fly collecting bucket (14) is sheathed with a rear cover body (15) and a front cover body (16).