Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for identifying authenticity of medicago sativa seed and detection method thereof

An alfalfa and kit technology, which is applied to the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of large error in identification results, difficulty in identification work, and high cost, and achieve rapid repeatability. Convenience, ensure purity identification, and ensure the effect of food safety

Inactive Publication Date: 2012-08-22
LANZHOU UNIVERSITY
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the shapes and colors of the seeds of the two grass species are very similar, it is difficult to distinguish them, especially due to the inconsistency of maturity, genetic variation between germplasms, and environmental, climate and other factors that cause changes in the appearance of the seeds. In this case The identification work is more difficult, and the error of the identification results is also larger; (2) Using the fluorescence method, the seeds for testing are evenly sown in the petri dish according to the standard germination method, placed in a 20°C incubator, and grown at 4, 8, respectively. , 12, 16, 20 and 24 hours to take out, move to the dark room and identify under the ultraviolet analyzer, the alfalfa seeds imbibed yellow fluorescence (Sun Jianhua, 1996)
Although this method can identify imbibed alfalfa seeds and sweet-scented clover seeds, it cannot be identified for the necrotic seeds and hard seeds of the two kinds of pastures, and has disadvantages such as low sensitivity, complicated process, and unknown mechanism; (3) Field identification, This method is to sow the seeds in the experimental field, observe once every 7-10 days after emergence, until 2-6 months, and finally identify alfalfa and sweet clover (Iannucci et al., 2002)
Although this method can accurately identify alfalfa and sweet-scented clover, its shortcomings are also very obvious. This method has the disadvantages of high cost, long cycle and low efficiency, which will seriously affect the planting and production of alfalfa.
Therefore, at present, there is no unified and effective method for identifying the authenticity of alfalfa seeds both at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for identifying authenticity of medicago sativa seed and detection method thereof
  • Kit for identifying authenticity of medicago sativa seed and detection method thereof
  • Kit for identifying authenticity of medicago sativa seed and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: a kind of special primer for identifying the authenticity of alfalfa seeds, comprising:

[0036] The first set of primers for alfalfa: MsITS-F (5'-3'): TTTTTGAACGCAAGTTGCGC,

[0037] MsITS-R (5'-3'): CAACCAACCACGAGACAGA;

[0038] The second group of special primers for sweet clover: MoITS-F (5'-3'): TTGGCCTCCCGTGAGCTCTATT,

[0039] MoITS-R (5'-3'): CTTTTCCTCCGCTTATTGATATGC.

Embodiment 2

[0040] Embodiment 2: a kind of kit for identifying the authenticity of alfalfa seeds, comprising:

[0041] Group 1: The total volume of the alfalfa PCR detection system is 19 μl, including 10 μl of 2×PCR Master (Shanghai Sangong, product number: SK2082), primer MsITS-F (5′-3′): TTTTTGAACGCAAGTTGCGC 1 μl, primer MsITS- R(5'-3'): CAACCAACCACGAGACAGA 1 μl, and ddH 2 O 7 μl;

[0042] The second group: the total volume of Melilotus clover PCR detection system is 19 μl, including 10 μl of 2×PCR Master (Shanghai Sangong, product number: SK2082), primer MoITS-F (5′-3′): TTGGCCTCCCGTGAGCTCTATT1 μl, primer MoITS- R(5'-3'):CTTTTCCTCCGCTTATTGATATGC1μl, and ddH 2 O 7 μl.

Embodiment 3

[0043] Embodiment 3: a kind of method for identifying the authenticity of alfalfa seeds, comprising the steps of:

[0044] A. Collect seeds, adopt the double-layer filter paper germination method, germinate for 72 hours at 20°C, and extract the genomic DNA of the germinated seeds for subsequent use (Plant Genomic DNA Extraction Kit, Tiangen Biochemical Technology Co., Ltd., catalog number: DP305);

[0045] B. Using the first set of special primers for alfalfa to perform PCR detection on the genomic DNA of the seeds. The total volume of the PCR detection system is 20 μl, including 2×PCR Master (3mM MgCl 2 , 0.2mM dNTP, 0.1U / μl Taq and 2×PCR Buffer) 10μl, DNA template (concentration is 200ng / μl) 1μl, primer MsITS-F (concentration is 10nM) 1μl, primer MsITS-R (concentration is 10nM) 1μl , and ddH 2 O 7 μl; PCR amplification conditions are: (1) pre-denaturation at 95°C for 2 minutes; (2) denaturation at 95°C for 30 seconds; (3) annealing at 61°C for 30 seconds; (4) extension at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention mainly relates to a method for identifying authenticity of a medicago sativa seed and special primers thereof, in particular to a gene detection kit of medicago sativa and melilotus albus and a detection method thereof. The kit for identifying the authenticity of the medicago sativa seed is mainly characterized in that: the total volume of a medicago sativa PCR (Polymerase Chain Reaction) detection system is 20 mul; and the kit comprises 2*PCR Master, the special primer MsITS-F (5'-3'): TTTTTGAACGCAAGTTGCGC and the special primer MsITS-R (5'-3'): CAACCAACCACGAGACAGA and ddH2O. Detection result shows that the technology can be used for identifying the authenticity of the medicago sativa seed, has the characteristics of high sensitivity, high accuracy, high repeatability, quickness, convenience and the like, has broad application prospect in medicago sativa industrial promotion of China, can guarantee that the production of livestock husbandry of China is served by the medicago sativa well and lays a solid foundation for guaranteeing grain safety of China.

Description

technical field [0001] The invention mainly relates to a method for identifying the authenticity of alfalfa seeds and special primers thereof. It specifically relates to a gene detection kit and a detection method for identifying the authenticity of alfalfa seeds. Background technique [0002] Alfalfa (Medicago sativa L.) is the leguminous forage with the largest planting area in my country and the world. It has the characteristics of high quality, high yield, high feeding value (21% crude protein content), good palatability, and wide application. Known as the "King of Grass". Sweet clover (Melilotus albus M.) and sweet clover (Mel.officinalis L.) are collectively referred to as sweet clover, their nutritional value is not only lower than that of alfalfa (crude protein content 16%), but also contains the toxic substance "coumarin". With a bitter taste, palatability is very low. The seeds, seedlings, leaves and hay of these two kinds of pastures are very similar in appearan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 刘志鹏马利超王彦荣
Owner LANZHOU UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More