Kit for identifying authenticity of medicago sativa seed and detection method thereof
An alfalfa and kit technology, which is applied to the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of large error in identification results, difficulty in identification work, and high cost, and achieve rapid repeatability. Convenience, ensure purity identification, and ensure the effect of food safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1: a kind of special primer for identifying the authenticity of alfalfa seeds, comprising:
[0036] The first set of primers for alfalfa: MsITS-F (5'-3'): TTTTTGAACGCAAGTTGCGC,
[0037] MsITS-R (5'-3'): CAACCAACCACGAGACAGA;
[0038] The second group of special primers for sweet clover: MoITS-F (5'-3'): TTGGCCTCCCGTGAGCTCTATT,
[0039] MoITS-R (5'-3'): CTTTTCCTCCGCTTATTGATATGC.
Embodiment 2
[0040] Embodiment 2: a kind of kit for identifying the authenticity of alfalfa seeds, comprising:
[0041] Group 1: The total volume of the alfalfa PCR detection system is 19 μl, including 10 μl of 2×PCR Master (Shanghai Sangong, product number: SK2082), primer MsITS-F (5′-3′): TTTTTGAACGCAAGTTGCGC 1 μl, primer MsITS- R(5'-3'): CAACCAACCACGAGACAGA 1 μl, and ddH 2 O 7 μl;
[0042] The second group: the total volume of Melilotus clover PCR detection system is 19 μl, including 10 μl of 2×PCR Master (Shanghai Sangong, product number: SK2082), primer MoITS-F (5′-3′): TTGGCCTCCCGTGAGCTCTATT1 μl, primer MoITS- R(5'-3'):CTTTTCCTCCGCTTATTGATATGC1μl, and ddH 2 O 7 μl.
Embodiment 3
[0043] Embodiment 3: a kind of method for identifying the authenticity of alfalfa seeds, comprising the steps of:
[0044] A. Collect seeds, adopt the double-layer filter paper germination method, germinate for 72 hours at 20°C, and extract the genomic DNA of the germinated seeds for subsequent use (Plant Genomic DNA Extraction Kit, Tiangen Biochemical Technology Co., Ltd., catalog number: DP305);
[0045] B. Using the first set of special primers for alfalfa to perform PCR detection on the genomic DNA of the seeds. The total volume of the PCR detection system is 20 μl, including 2×PCR Master (3mM MgCl 2 , 0.2mM dNTP, 0.1U / μl Taq and 2×PCR Buffer) 10μl, DNA template (concentration is 200ng / μl) 1μl, primer MsITS-F (concentration is 10nM) 1μl, primer MsITS-R (concentration is 10nM) 1μl , and ddH 2 O 7 μl; PCR amplification conditions are: (1) pre-denaturation at 95°C for 2 minutes; (2) denaturation at 95°C for 30 seconds; (3) annealing at 61°C for 30 seconds; (4) extension at ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com