Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

44 results about "Genetic heredity" patented technology

Genetics is the study of heredity. Heredity is a biological process where a parent passes certain genes onto their children or offspring. Every child inherits genes from both of their biological parents and these genes in turn express specific traits.

Breeding method of high-rice-blast-resistance rice intermediate materials

ActiveCN102783407AStrong resistance to rice blastOutstanding rice blast resistancePlant genotype modificationBiotechnologyResistant genes
The invention discloses a breeding method of high-rice-blast-resistance rice intermediate materials, and particularly provides a method for breeding the high-rice-blast-resistance rice intermediate materials with the advantages that molecular markers are adopted for assisting the selection, and the anther culture is adopted for accelerating the stabilization. The method provided by the invention has the advantages that through the hybridization of rice-blast-resistance genes between different gene sites, the rice-blast-resistance genes are continuously polymerized, and the bred intermediate materials have very high resistance on the rice blast. The selected intermediate materials for the rice-blast-resistance gene polymerization have very prominent rice blast resistance, and can be widely used for improving the rice varieties with good integral properties but poor rice blast resistance. The interlocking between the rice-blast-resistance genes and rice-blast-sensitive genes on other gene sites is broken through anther, and the rice-blast-resistance genes are polymerized. The selected rice-blast-resistance material genes have very rich genetic backgrounds, filial generations prepared by using the selected rice-blast-resistance material genes as parents have very prominent resistance on the rice blast, and the new rice varieties with high rice blast resistance can be more easily obtained through breeding.
Owner:ZHENJIANG AGRI SCI INST JIANGSU HILLY AREAS

Mapping of eggplant fruit color epistatic gene D, and InDel molecular marker development and application thereof

The invention discloses a mapping result of an eggplant fruit color epistatic gene D. The gene D is mapped in a position near a nucleotide sequence Sme2.5_00538.1 on a No.10 chromosome of the eggplant. Based on the re-sequencing result of male and female parents, an InDel molecular marker closely linked with the eggplant fruit color epistatic gene D is obtained near the nucleotide sequence Sme2.5_00538.1 of the No.10 chromosome, and is named as InDel22522; the genetic distance of the marker from the epistatic gene D is 0.61 cM. The nucleotide sequence of the molecular marker InDel 22522 in the female parent has one 29-basic-group InDel more than that in the male parent. The mapping result on the eggplant fruit color epistatic gene D provided by the invention lays the foundation for the precise positioning and cloning of the eggplant fruit color epistatic gene; the InDel 22522 molecular marker and a molecular marker amplification primer can be applied to eggplant fruit color breeding practice in a way of simplicity, convenience, high speed and high flux; the eggplant fruit color property improving process is accelerated.
Owner:INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI

InDel molecular marker closely linked with epistatic gene P of eggplant fruit color and application of InDel molecular marker

The invention discloses an InDel molecular marker closely linked with an epistatic gene P of eggplant fruit color and application of the InDel molecular marker. The genetic distance between the InDelmolecular marker and the epistatic gene P is 0.5cM, and InDel of specific insertion / deletion fragments at 50bp and 35bp in nucleotide sequences of the male parent is not found from the female parent.The InDel molecular marker closely linked with the epistatic gene P of the eggplant fruit color, disclosed by the invention, lays a foundation for fine mapping and cloning of the epistatic gene of theeggplant fruit color. An InDel 5513 molecular marker and a molecular marker amplification primer can be simply and rapidly applied in eggplant fruit color breeding practice at high flux, so that theprogress of improving fruit color characters of eggplants is accelerated.
Owner:INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI

User recommendation method and device based on block chain, equipment and storage medium

The invention discloses a user recommendation method and device based on a block chain, equipment and a storage medium, and belongs to the technical field of block chains. The embodiment of the invention provides a technical scheme for recommending marriage friends by utilizing a block chain, specifically including the steps: storing the gene information of the user in the block chain, and when the user needs to recommend the marriage object, matching the gene information of the user with the gene information of other users respectively to find the user matching the gene information of the user, so that the proper marriage object is recommended to the user. As the block chain technology has the characteristic of decentralization, the block chain is used for storing the gene information, toavoid the risk of data leakage caused by the fault of the centralized node, and avoid the risk of gene information leakage of a user. Moreover, since the gene information contains rich characteristics such as characters and gene genetic risks, the marriage objects are matched by using the gene information, so that the marriage objects generally matched with the characters of the user can be found, and the risk of gene inheritance is avoided.
Owner:TENCENT TECH (SHENZHEN) CO LTD

Method for measuring pig gene polymorphism and relevance between pig gene polymorphism and sow reproduction traits

ActiveCN105368926AMicrobiological testing/measurementEar tissue sampleGene targets
The invention discloses a method for measuring pig gene polymorphism and relevance between pig gene polymorphism and sow reproduction traits. The method includes the following steps of firstly, collecting a pig ear tissue sample; secondly, extracting ear tissue DNA; thirdly, amplifying RBP4 and BMP7 gene target segments through a PCR; fourthly, conducting SSCP analysis; fifthly, conducting bidirectional sequencing on a PCR amplification product; sixthly, conducting population genetics characteristic analysis; seventhly, measuring reproductive performance; eighthly, analyzing the relevance between detected RBP4 and BMP7 gene heritable variation and sow reproduction trait indexes through a mathematical model. The method has the advantages of being high in detecting efficiency and reliable in result.
Owner:安徽大自然种猪股份有限公司

Plant polygene genetic transformation method

The invention discloses a plant polygene genetic transformation method, and belongs to the technical field of plant biological engineering. The method comprises establishing a single-genotype high-quality high-agrobacterium-infection-rate embryonic callus line; and infecting the above callus line by using grobacterium with different binary vectors, and performing double-antibody screening to obtain a transgenic positive plant containing multiple different exogenous genes. The method is mainly used to solve the problem that plant is difficult for genetic transformation and multiple-property comprehensive improvement. Experiment data show that the method can help to successfully obtain the positive transgenic plant possessing the single genotype background within 4-5 months, the genetic transformation efficiency is up to 60%, the target of converting 200 gene vectors per person per year can be realized, and the working efficiency of generating 3000 independent positive transgenic plants containing multiple different exogenous target genes can be provided.
Owner:QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI

Method for detecting GCK-MODY gene mutation and kit for method

The invention provides a method for determining a quantity of DNA aggregate samples (DNA pooling) during gene detection on single-gene hereditary diseases of people. The method can be applicable to efficient analysis on a large number of samples, and the cost of gene detection on the single-gene hereditary diseases of the people can be reduced remarkably. By a primer group provided by the invention, GCK-MODY sequencing and GCK gene mutation detecting of a large number of samples can be achieved.
Owner:BIOISLAND LAB +1

Gene GF14e and protein capable of improving rice neck blast resistance, and applications of the gene

The invention discloses a gene GF14e and a protein which are capable of improving rice neck blast resistance, and applications of the gene. The gene has a nucleotide sequence shown as SEQ ID No:1. The rice gene GF14e is proved to be a functional gene for rice neck blast resistance for the first time. Cloning and biological function verification of the gene have great reference significance for molecular mechanism research of the rice neck blast resistance. The expression quantity of the GF14e is greatly increased after rice is transformed with a rice transformation overexpression vector over-expressing the GF14e gene, rice neck blast resistance of transformed plants is obviously improved along with the increased expression quantity, and growth states and agronomic traits of transgenic plants are hardly changed. A GF14e overexpression technique can be applied for genetic engineering breeding of rice, and can be applied to production practice to improve the rice neck blast resistance, thus ensuring rice production safety under weather conditions with frequent rice diseases at present.
Owner:RICE RES INST GUANGDONG ACADEMY OF AGRI SCI

Standard plasmid for detecting copy number of exogenous gene of recombinant CVA10 vaccine as well as preparation method and application of standard plasmid

The invention provides a standard plasmid for detecting the copy number of an exogenous gene of a recombinant CVA10 vaccine as well as a preparation method and application of the standard plasmid. The standard plasmid is formed by connecting an endogenous gene MOX fragment SEQ ID No.1, an exogenous gene P1 fragment SEQ ID No.2 and an exogenous gene 3CD fragment SEQ ID No.3 in series in a cloning vector. According to the method, the copy number of the inserted exogenous gene is simply, conveniently, rapidly, absolutely quantitatively and accurately analyzed by constructing the standard plasmid and adopting a Taqman probe-fluorescent quantitative PCR method, so that the detection time for determining the copy number of the exogenous gene of the recombinant CVA10 vaccine is effectively shortened, repeated operation is facilitated, and the detection efficiency is improved. The method has a wide application prospect in the determination of the copy number of the recombinant CVA10 vaccine exogenous gene constructed based on a hansenula polymorpha platform and the verification of the genetic stability of the recombinant CVA10 vaccine exogenous gene.
Owner:BEIJING MINHAI BIOTECH

Testing method and application of hereditary variation of CRBPI (Cellular Retinol-Binding Protein Type I) gene of chicken

The invention discloses a testing method of hereditary variation of CRBPI (Cellular Retinol-Binding Protein Type I) gene of chicken, which comprises the steps of: extracting a genome DNA of a chicken blood sample; carrying out PCR (Polymerase Chain Reaction) amplification on the genome DNA, wherein the sequence of an upstream primer used in PCR amplification is TAAATTTATAGTTGCGGTCAT, and the sequence of a downstream primer is AGTTCCAGGTGACGGGTGAG; and carrying out gel electrophoresis on the amplification products and photographing the amplification products, and analyzing the electrophoresisresult, wherein the polymorphism of the 14604 locus G / T of the chicken genome is relevant to the egg laying traits (such as egg yield, breeding weight, first egg weight and the like), and the selected single nucleotide polymorphism locus is used for assisting breeding and can accelerate the breeding process of poultry.
Owner:SICHUAN AGRI UNIV

Method for auxiliary detection of growth and carcass traits of cattle by heritable markers of cattle SERPINA3 gene and application thereof

The invention discloses a method for auxiliary detection of growth and carcass traits of cattle by heritable markers of a cattle SERPINA3 gene and an application thereof. A whole genome DNA of the cattle to be tested is used as a template, a part of fragments of the cattle SERPINA3 gene are amplified by PCR, and genetic heritable variation detection is performed by a PCR-RFLP technology. The detection method is simple and fast, low in cost, and accurate and reliable in detection results, is suitable for large-scale genotyping of genetic heritable mutation loci of the cattle SERPINA3 gene, provides new heritable markers for molecular marker assistant selection of the growth and carcass traits of the cattle, thereby speeding up the establishment of cattle populations with excellent heritableresources.
Owner:NORTHWEST A & F UNIV

Method for detecting bovine growth and carcass traits with assistance of TNNI1 gene and special kit

The invention discloses a method for detecting bovine growth and carcass traits with assistance of a TNNI1 gene and a special kit. The to-be-detected bovine whole genome DNA is adopted as a template; the TNNI1 gene is subjected to PCR amplification; the detection and the rapid typing of genetic vibration of the gene are performed through a PCR-RFLP technology of artificially introducing a restriction enzyme cutting site. The method disclosed by the invention has the advantages of simplicity, low cost and accurate and reliable detection result, is suitable for large-scale genotyping of the genetic vibration site of the bovine TNNI1 gene and can be applied to the molecular marker-assisted selection of the bovine growth and carcass traits to achieve an aim of quickly establishing a bovine population with good genetic resources.
Owner:NORTHWEST A & F UNIV

Preparation method of maltooligosyltrehalose hydrolase gene sequence and recombinant protein thereof

The preparation method of the invention comprises the following steps: the genetic codon of maltooligosyltrehalose hydrolase (MTHase) gene is modified artificially, yeast preferred codon is synthesized and the A / T content of the genetic codon is modified, a MTHase gene sequence of which structure of genetic codon is optimized and A / T content is reduced is obtained; then the complete MTHase gene is cloned to the yeast expression vector pPICZ alpha A, recombinant vector is screened out and introduced in Pichia Pastoris cell to perform recombinant expression; and a yeast strain which can efficiently and stably express MTHase can be obtained. The enzyme activity of MTHase which is secreted by the yeast strain in the supernate of expression culture medium is more than 800mg / L, thus the preparation method of the invention lays a foundation for the industrial production of trehalose which adopts enzyme process and uses starch as raw material.
Owner:CHENGDU UNIV

Determination method of rock uniaxial compressive strength empirical formula

The invention discloses a determination method of a rock uniaxial compressive strength empirical formula. The method comprises the following steps: firstly, collecting an L-shaped Schmidt hammer rebound value and rock uniaxial compressive strength experimental data; and then, achieving chromosome sequence hybridization and variation composed of mathematical symbols, fitting coefficients and L-type Schmidt hammer springback values through a genetic expression algorithm, and determining whether the gene sequences are eliminated or not according to the adaptive value of each chromosome gene sequence, therefore, an empirical formula which can best represent the L-shaped Schmidt hammer rebound value and the rock uniaxial compressive strength is continuously iterated. The method overcomes the subjectivity in the determination process of a traditional empirical formula, and the determined empirical formula can be suitable for determining the uniaxial compressive strength of the rock and is wide in application range.
Owner:HUNAN UNIV OF SCI & TECH

Construction method and device for cerebral apoplexy multi-gene genetic risk comprehensive score (metaPRS) and application

ActiveCN113012761AHealth-index calculationBiostatisticsGenetic heredityPhenotype determination
The invention provides a construction method and device for a cerebral apoplexy multi-gene genetic risk comprehensive score (metaPRS) and the application thereof. The construction method of the cerebral apoplexy multi-gene genetic risk comprehensive score (metaPRS) comprises the following steps: screening a set of SNP (Single Nucleotide Polymorphism) related to cerebral apoplexy or cerebral apoplexy related phenotypes; detecting the genotype of the to-be-detected SNP of the individual; respectively extracting dangerous alleles, effect values and P values of the detected SNP corresponding to a plurality of sub-phenotypes from a whole genome correlation research result, constructing a plurality of candidate sub-phenotype PRSs, and screening an optimal sub-phenotype PRS; determining the weight of each sub-phenotype PRS; the weight of the subphenotype PRS is converted into the weight of the SNP level; constructing a comprehensive score metaPRS of the multi-gene genetic risk of the cerebral apoplexy; and evaluating the effect of metaPRS on cerebral apoplexy risk prediction and layering. The method is of great significance to assessment of cerebral apoplexy onset risk.
Owner:FUWAI HOSPITAL CHINESE ACAD OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE

Preparation method of anti-African swine fever cloned pig

The invention discloses a preparation method of an anti-African swine fever cloned pig and belongs to the field of animal genetic engineering and genetic modification. A CRISPR / Cas9 gene knock-in technology is used, a CRISPR / Cas9 targeting vector and a pig Rosa26 gene donor vector are jointly transferred into a pig fibroblast to obtain a positive cell clone, a first intron of the pig Rosa26 gene in the positive clone is knocked in a gene capable of expressing sgRNA-Cas9 of a specific targeted knockout virus pE248R gene, such that the pE248R gene is knocked out in a targeted manner when viruses are propagated in vivo and a pig has ASFV resistance; a cloned embryo is obtained through a somatic cell nuclear transfer technology; and the cloned embryo are transferred into a pig uterus for pregnancy to obtain a cloned pig. The sgRNA-Cas9 system is knocked into a pig body for the first time and stably expressed to obtain ASFV resistance, such that a foundation is laid for breeding research on African swine fever resistance.
Owner:GUANGDONG OCEAN UNIVERSITY

InDel molecular marker closely linked with gen of rice in heading stage and application

The invention discloses an InDel molecular marker closely linked with a gene of rice in a heading stage and an application. The molecular marker IN2 has an upstream primer sequence of SEQ ID NO. 2 anda downstream primer sequence of SEQ ID NO. 3. The invention discloses the application of the InDel molecular marker IN2 in genetic analysis and fine gene mapping of the rice in the heading period. The molecular marker IN10 has an upstream primer sequence of SEQ ID NO. 6 and a downstream primer sequence of SEQ ID NO. 7. The invention discloses the application of the InDel molecular marker IN10 ingene genetic analysis and gene fine mapping of the rice in the heading stage.
Owner:BIOTECH RES CENT SHANDONG ACADEMY OF AGRI SCI

Automated interpretation system for genetic mutation of aortic disease (HTAADVar)

The invention relates to the field of bioinformatics analysis, and particularly provides a hereditary aortic disease (HTAAD) mutation automatic interpretation system and a construction method thereof, and by constructing a disease-related gene genetic mutation database, automatic interpretation of diseases is realized based on interpretation specifications; compared with a traditional method, the automatic interpretation system has the advantages of being high in interpretation efficiency, good in flexibility, high in sensitivity, good in specificity, high in accuracy and the like, and has a good clinical application prospect.
Owner:FUWAI HOSPITAL CHINESE ACAD OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE

Jiaxing black pig TFB2M gene characteristic sequence, primer and detection kit

The invention relates to a Jiaxing black pig TFB2M gene characteristic sequence and a specific amplification primer, and a detection kit for Jiaxing black pig pork quality related traits including theTFB2M gene characteristic sequence and the specific amplification primer. Correlation analysis between the expression level of the TFB2M gene and the pork quality traits and carcass traits of Jiaxingblack pigs is carried out, and a genetic mechanism related to Jiaxing black pig pork traits is explored from the molecular level, in order to provide theoretical basis corresponding to improvement ofthe meat quality of local pigs, protection of germplasm resources of Jiaxing black pigs, and development and utilization, and provide great significance for improving fertility of low-yield varietiesand improving meat quality.
Owner:ZHEJIANG UNIV

Rapid genotype identification method suitable for map-based cloning

The invention belongs to the technical field of genetics and specifically relates to a rapid genome DNA extraction and genotype identification method suitable for map-based cloning. The rapid genotypeidentification method suitable for map-based cloning utilizes crop seedlings as verification samples, performs verification with a general DNA extraction method and performs PCR amplification throughreasonably designed primers, so that the method can rapidly finish the rapid extraction of genome DNA and the rapid identification of genotypes. Thus, repetitive work can be greatly reduced, costs and time can be saved, work progress can be accelerated; and the method can be used for reference in other crops as well.
Owner:MAIZE RES INST SHANDONG ACAD OF AGRI SCI

Device for non-invasively detecting genetic abnormalities of mother and embryo

The invention provides a device for non-invasively detecting genetic abnormalities of a mother and an embryo. According to the device, the non-invasive detection on genetic abnormalities of the embryois achieved, and aneuploidy of chromosomes of the embryo can be simultaneously non-invasively detected; and the genetic abnormalities of the mother can be simultaneously detected. Relative to commonly used non-invasive antenatal embryo chromosome aneuploidy detection, the device provided by the invention is added with the new detection function without increasing the detection cost, and the costis greatly saved.
Owner:首度生物科技(苏州)有限公司

A Strain of Avian Encephalomyelitis Virus and Its Application

The present invention relates to the field of animal virology, and provides a strain of avian encephalomyelitis virus and its application, specifically provides a strain of avian encephalomyelitis virus, named AEV JN, and its preservation number is: CGMCC No.16385, It also provides the isolation and identification process of the virus strain. Through the genetic evolution analysis of the VP1 gene, it is confirmed that it is in the same branch as the internationally recognized AEV virulent strain VR strain, and has a close relationship. It fills in the relevant gaps in my country. As a vaccine strain, it can well complement the existing 1143 strains of live vaccine commonly used in my country, and provide better protection for my country's poultry breeding industry.
Owner:POULTRY INST SHANDONG ACADEMY OF AGRI SCI

A rapid genotype identification method suitable for map-based cloning

The invention belongs to the technical field of genetics, and in particular relates to a method for rapid extraction of genomic DNA and rapid genotype identification suitable for map-based cloning. The genotype rapid identification method suitable for map-based cloning described in the present invention uses crop seedlings as verification samples, verifies with a general DNA extraction method, and performs PCR amplification by designing reasonable primers, which can quickly complete the rapid extraction of genomic DNA The rapid identification of genotypes greatly reduces duplication of labor, saves cost and time, and speeds up work progress. This method can also be used for reference in other crops.
Owner:MAIZE RES INST SHANDONG ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products