Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

164 results about "Yellow fever viruses" patented technology

Yellow fever is caused by a bite from a mosquito that is infected with the yellow fever virus. Understanding the Yellow Fever Virus. The yellow fever virus is a flavivirus (virus transmitted by mosquitoes) found in certain parts of Africa and South America.

Use of imatinib to treat liver disorders and viral infections

The present invention relates to the use of imatinib for treating viral liver diseases and in particular for viral hepatitis. The invention provides the use of imatinib for inhibiting replication, transmission or both of hepatitis viruses. The invention further relates to the use of imatinib for inhibiting replication, transmission or both of other viruses including herpes virus, poxvirus, influenza virus, para influenza virus, respiratory syncytial virus, rhinovirus, yellow fever virus, west nile virus, and encephalitis virus.
Owner:BIONICHE LIFE SCI

Methods for real-time multiplex isothermal detection and identification of bacterial, viral, and protozoan nucleic acids

Herein disclosed are rapid real-time isothermal multiplex methods of detecting, identifying and quantifying bacterial, viral, and protozoan nucleic acids in a sample. These include contacting the sample with two or more sets of pathogen-specific reverse transcription loop-mediated isothermal amplification primers and novel oligofluorophores specific for the target bacterial, viral, and parasitic nucleic acids of interest such as human immunodeficiency virus, Ebola virus, Marburg virus, Yellow fever virus, hepatitis-B virus, Lassa fever virus, Plasmodium, hepatitis-C virus, hepatitis-E virus, dengue virus, Chikungunya virus, Japanese Encephalitis virus, Middle Eastern Respiratory Syndrome Corona virus, Mycobacterium, West Nile virus, Cytomegalovirus, Parvovirus, Leishmania, Trypanosoma, and Zika virus nucleic acids, under conditions sufficient to produce detectable real-time amplification signals in about 10 to 40 minutes. The amplification signals are produced by pathogen-specific fluorogenic labels included in one or more of the primers. Also, novel reaction and sample lysis buffers, primers, and kits for rapid multiplex detection, quantification, and identification of bacterial, viral, and protozoan nucleic acids by real-time isothermal amplification are herein disclosed.
Owner:NYAN DOUGBEH CHRIS

Methods for real-time multiplex isothermal detection and identification of bacterial, viral, and protozoan nucleic acids

Herein disclosed are rapid real-time isothermal multiplex methods of detecting, identifying and quantifying bacterial, viral, and protozoan nucleic acids in a sample. These include contacting the sample with two or more sets of pathogen-specific reverse transcription loop-mediated isothermal amplification primers and novel oligofluorophores specific for the target bacterial, viral, and parasitic nucleic acids of interest such as human immunodeficiency virus, Ebola virus, Marburg virus, Yellow fever virus, hepatitis-B virus, Lassa fever virus, Plasmodium, hepatitis-C virus, hepatitis-E virus, dengue virus, Chikungunya virus, Japanese Encephalitis virus, Middle Eastern Respiratory Syndrome Corona virus, Mycobacterium, West Nile virus, Cytomegalovirus, Parvovirus, Leishmania, Trypanosoma, and Zika virus nucleic acids, under conditions sufficient to produce detectable real-time amplification signals in about 10 to 40 minutes. The amplification signals are produced by pathogen-specific fluorogenic labels included in one or more of the primers. Also, novel reaction and sample lysis buffers, primers, and kits for rapid multiplex detection, quantification, and identification of bacterial, viral, and protozoan nucleic acids by real-time isothermal amplification are herein disclosed.
Owner:NYAN DOUGBEH CHRIS

Recombinant antigen protein for detecting yellow fever virus antibody, kit and application of recombinant antigen protein

The invention discloses a recombinant antigen protein for detecting a yellow fever virus antibody. The sequence of the recombinant protein is shown as SEQ ID NO.1; the sequence of an encoding gene of the recombinant antigen protein is shown as SEQ ID NO.2, and comprises an extension segment for encoding a flexible arm of the recombinant antigen protein; and the flexible arm can be used for eliminating masking of a peptide epitope by a fusion protein of an expression carrier, so that the expressed recombinant antigen protein is folded correctly. The invention further discloses a preparation method of the recombinant antigen protein. Moreover, a yellow fever virus kit disclosed by the invention comprises an antigen detection plate coated with the recombinant antigen protein and an ELISA (Enzyme-Linked Immunosorbent Assay) reaction liquid. The recombinant antigen protein provided by the invention has the advantages of high specificity and high affinity, does not undergo any serological cross reaction with other congenial arthropod-borne viruses, has ultrahigh affinity with the yellow fever virus antibody, and can be used for detecting the yellow fever virus antibody rapidly and accurately for diagnosing the infection condition of a yellow fever virus.
Owner:中国人民解放军南部战区疾病预防控制中心

Reagent and method for detecting yellow fever virus

The invention provides a reagent for detecting yellow fever virus. The reagent comprises an outer primer F3, an outer primer B3, an inner primer FIP, an inner primer BIP, wherein primer gene sequences are as follows: the outer primer F3: TGGGAGAGGAGATTCACGT; the outer primer B3: TCAAGCCGCCAAATAGCC; the inner primer FIP: CCACGCCTTTCATGGTCTGAGTTTACCAGTGGCACAAAGAGG; and the inner primer BIP: AGACACCGCCTGGGATTTYAGGCAGAGCCAAACACCGTATG. The primers do not have isogeny with nucleotide sequences of other species, so that the specificity of a detection method is ensured. The method for detecting the yellow fever virus through isothermal amplification established by the primers has the advantages of simplicity and convenience in operation, high efficiency, quickness and specificity. Due to the establishment of the method, a blank of the yellow fever virus isothermal nucleic acid amplification detection method is filled, the detection on a sample can be completed by taking around one hour, and significance is provided for preventing the introduction of yellow fever virus in frontier ports.
Owner:浙江国际旅行卫生保健中心

Methods of treatment and diagnosis using modulators of virus-induced cellular gene sequences

InactiveUS20070087982A1Reduce expressionReducing and preventing expression of mRNABiocideGenetic material ingredientsDiseaseImmunodeficiency virus
Applicants have used microarrays, gene expression profiling, and gene silencing methods to identify and provide a plurality of ‘validated’ virus-induced cellular gene sequences (e.g., HMG20B, HRH1, NP and c-YES (src family kinases)) and pathways useful as therapeutic targets for modulation of viral-mediated cellular effects. Particular embodiments provide therapeutic compositions, and methods for modulation of viral infection, replication, maturation, progression, or other virally-related conditions or diseases, comprising inhibition of virally-induced gene sequences and gene products. Additional embodiments provide screening assays for compounds useful to modulate viral infection, replication, maturation or progression, or viral-related conditions or diseases. Further embodiments provide diagnostic and/or prognostic assays for viral infection, replication, maturation or progression. Preferably, the viruses all selected from the group consisting of retroviruses (e.g., human immunodeficiency virus (HIV), and viruses of the family Flaviviridae that includes the flaviviruses (e.g., West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV) and Dengue fever virus (DEN)), and hepatitis C virus (HCV).
Owner:OREGON HEALTH & SCI UNIV

Fulminating-infectious-disease pathogen detecting primer pair and kit

The invention discloses a fulminating-infectious-disease pathogen detecting primer pair and a kit. The primer pair comprises at least a pair of RT-LAMP primers of Ebola viruses, Lassa fever viruses, Marburg viruses, rift valley fever viruses, yellow fever viruses and Chikungunya fever viruses. By means of the primer system, the amplification reaction background is reduced, and sensitivity and specificity are quite good. The kit formed by the primer pair further comprises detecting liquid and a micro-fluidic chip; as an independent RT-PCR secondary amplification step of a detecting liquid system is omitted, detecting time is shortened; as the denaturation process and the renaturation process of nucleic acid do not exist, the polluted chance of RNA enzymes and the polluted chance of amplification nucleic acid are reduced, and the sensibility and the safety of detection are improved. By means of the constant-temperature sealed environment provided by a micro-fluidic chip system, rapid and constant-temperature amplification and automation result distinguishing of a nucleic acid extracting template are finally achieved, the requirement for test hardware is reduced, the use level of a reaction reagent is reduced, detection cost is reduced, and the result can be directly determined through color changes.
Owner:INST OF PLA FOR DISEASE CONTROL & PREVENTION

Multiplex-fluorescence PCR (Polymerase Chain Reaction) detection kit and application thereof

The invention relates to the technical field of biological detection, and in particular relates to a primer, a probe and a kit used for detecting dengue fever, chikungunya and yellow fever virus through a single tube by the multiplex-fluorescence PCR (Polymerase Chain Reaction). The primer and probe used for detecting the dengue fever, chikungunya and yellow fever virus through the multiplex-fluorescence PCR have nucleotide sequences as shown in SEQ ID NO: 1-9; the multiplex PCR detection kit for detecting the dengue fever, chikungunya and yellow fever virus comprises multiplex-fluorescence PCR detection mixed liquid which contains the primer and probe mentioned above. The kit, primer and probe can quickly detect the dengue fever virus, chikungunya virus and yellow fever virus, have the advantages of being simple and convenient to operate, high in sensitivity and outstanding in specificity, and can timely find out and confirm a suspect case so as to improve the monitoring level on such diseases.
Owner:浙江国际旅行卫生保健中心 +1
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products