Reagent and method for detecting yellow fever virus
A yellow fever virus and reagent technology, which is applied in the field of temperature amplification technology to detect yellow fever virus, can solve the problems of limited application, specificity, insufficient simplicity of operation, influence of amplification efficiency and speed, etc., and achieves the effect of easy operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] The detection of embodiment 1 yellow fever virus
[0023] 1. Primer design
[0024] Download representative yellow fever virus sequences from GenBank, select 33 strains of yellow fever virus from 1940 to 2010 and the E gene sequences of vaccine strain yellow fever virus, compare the yellow fever virus E gene sequences with DNAStar software, according to the target Design 4 primers for 6 specific regions in the gene, and design a set of primers (F3, B3, FIP, BIP), which are outer primer B3, outer primer F3, inner primer FIP, and inner primer BIP. The primer gene sequence is as follows:
[0025] Outer primer F3: TGGGAGAGGAGATTCACGT;
[0026] Outer primer B3:TCAAGCCGCCAAATAGCC;
[0027] Inner primer FIP:
[0028] CCACGCCTTTCATGGTCTGAGTTTACCAGTGGCACAAAGAGG;
[0029] Inner primer BIP:
[0030] AGACACCGCCTGGGATTTYAGGCAGAGCCAAAACACCGTATG.
[0031] 2. Extraction of viral RNA
[0032] Dissolve the live attenuated yellow fever virus vaccine with physiological saline acco...
Embodiment 2
[0041] Embodiment 2, detection of yellow fever virus in entry-exit fever personnel
[0042] Use the serum of 23 fever patients who entered the airport port, and use the RNA extraction kit to extract DNA according to the instructions. The RT-LAMP reaction system is as follows: 20mmol / l Tris-HCl, 10mmol / l KCl, 10mmol / l (NH4) 2 SO4, 8mmol / l MgSO 4 , 0.1% Tween-20, the concentration ratio of outer primer and inner primer is 1:8, outer primer F3 and B3 are both 5pmol / l, inner primer BIP and FIP 40pmol / l, 0.8mol / l betaine, dNTP 1.4mmol / l l, 10UAMV reverse transcriptase, 8U Bst-DNA polymerase, 5μl RNA template, complement DEPC-H 2 0 to 25 μl. Sterilized double distilled water was used as negative control, and yellow fever virus vaccine strain was used as positive control. The reaction program was 63°C, 60 minutes. The reaction results of serum samples from 23 patients with fever were centrifuged at 6000rpm, no precipitation was seen for 3 minutes, no green fluorescence was produc...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com