Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

67 results about "Staphylococcus aureus enterotoxin" patented technology

Staphylococcus aureus Enterotoxins. The S. aureus enterotoxins (SEs) are potent gastrointestinal exotoxins synthesized by S. aureus throughout the logarithmic phase of growth or during the transition from the exponential to the stationary phase [16,17,18,19,20].

Immunity colloidal gold test paper strip for detecting and staphylococcal enterotoxin A and its production method

The invention discloses an immune colloidal gold test paper strip for detecting staphylococcus aureus enterotoxin A and a preparation method, comprising the construction of engineering bacteria of expression recombinant SEA protein, the separation and the purification of the SEA protein, the preparation of an anti-SEA specific antibody and the preparation of the SEA colloidal gold test paper strip. The test paper strip consists of a sample pad, a colloidal gold marker pad which is coated by a colloidal gold marker-labeled anti-SEA antibody and a cellulose nitrate film which is coated by an anti-SEA antibody and an anti-mouse IgG at a detection line and a quality control line; furthermore, the sample pad, the colloidal gold marker pad, the cellulose nitrate film and a water absorbent pad are sequentially adhered on a PVC bottom plate. The test paper strip has convenient, rapid and accurate operation, the whole process only needs 10 minutes and is not interfered by the environmental conditions, the specificity is good, the detection sensitivity is high and the lowest detection limit is 1ng / ml. The test paper strip is applicable to customs, hospitals and inspection quarantine institutions, etc., which can further realize the rapid detection of the staphylococcus aureus enterotoxin A in foods or in clinical samples.
Owner:SHENZHEN UNIV +1

Super antigen fusion protein for cancer therapy and its producing method

Disclosed is a super antigen fusion protein for cancer therapy and its producing method, wherein the invention provides a method for constructing fusion protein of cytokine and super antigen, and the method of expression and purification of the fusion protein in escherichia coli, the used material is epidermal growth factor EGF and vessel endothelial cell growth factor VEGF and staphylococcus aureus enterotoxin SEA, two fusion protein types of EGF-SEA and VEGF-SEA can be constructed, the fusion proteins can be used for treating cancer.
Owner:孙嘉琳

Nucleic acid aptamers for specifically recognizing Staphylococcus aureus enterotoxin A

The invention discloses nucleic acid aptamers for specifically recognizing Staphylococcus aureus enterotoxin A, belonging to the technical field of biology of food safety. The invention aims to overcome the defect of no nucleic acid aptamers for Staphylococcus aureus enterotoxin A in the prior art. After 12 times of repeated analysis and verification of screening as well as affinity and specificity testing, the nucleic acid aptamers with favorable affinity and specificity for Staphylococcus aureus enterotoxin A are obtained. The invention provides specific and efficient recognition aptamers for analyzing and detecting the Staphylococcus aureus enterotoxin A in food or environment, and provides a new option for developing and substituting the existing method for detecting Staphylococcus aureus enterotoxin A on the basis of antibodies.
Owner:JIANGNAN UNIV

Recombinant staphylococcus aureus enterotoxin M and its prepn and application

The recombinant staphylococcus aureus enterotoxin M as one kind of superantigen with the amino acid sequence as shown in SEQ ID No. 1 is obtained through recombining gene originated from staphylococcus aureus and coding SEM with one kind of plasmid vector, transforming to proper host for expressing, and affiliation purifying. It is proved through extracorporeal mouse spleen lymphopoiesis experiment and tumor cell inhibiting experiment that the recombinant protein has typical superantigen activity stronger than that of SEC and may be applied in preparing medicine for stimulating lymphopoiesis and inhibiting tumor cell growth. The present invention is suitable for preparing high purity enterotoxin with superantigen activity and developing superantigen preparation. The present invention has reasonable design, efficient expression on recombinant SEM in the expression strength of about 15-25 % of staphylococcus aureus protein, and other advantages.
Owner:ZHEJIANG UNIV

Staphylococcus aureus enterotoxin 1 and preparation and use

The present invention provides a kind of recombinant staphylococcus aureus enterotoxin I prepared through genetic engineering process, and the protein is one kind of super antigen with the amino acid sequence of SEQ ID No. 1. The recombinant plasmid is reconstructed with pGEX-4T-1 and the nucleotide sequence of SEQ ID No. 2. Extracorporeal experiment shows that the prepared high purity recombinant SEI protein can excite the splenic lymphopoiesis of mouse effectively in dosage depending relationship and the excited splenic lymphocyte of the mouse has obvious tumor cell killing effect. Compared with available staphylococcus aureus enterotoxin C as the main effective component in the staphylococcus aureus filtrate preparation, the recombinant SEI protein has even high super antigen activity and may be prepared into super antigen preparation for inhibiting tumor growth effectively.
Owner:HANGZHOU MINSHENG PHARM CO LTD

PCR (polymerase chain reaction) synchronous detection kit for staphylococcus aureus enterotoxin A and B genes

The invention discloses a PCR (polymerase chain reaction) synchronous detection primer for staphylococcus aureus enterotoxin A and B genes, a detection kit thereof and a detection method. The nucleotide sequence of the synchronous detection primer is as shown in SEQ (sequence) ID (identity) No. 1 and 2. The invention further provides the PCR detection kit containing the primer. By adopting the detection kit, the staphylococcus aureus enterotoxin A and B in a food can be accurately and sensitively detected, and the lowest detection concentration of DNA (deoxyribonucleic acid) is 3.58ng; furthermore, the detection kit has no cross reaction with other bacteria, and the specificity is good; simultaneously, the pretreatment process of samples is simple, the consumed time is short, a large number of the samples can be detected simultaneously, and the cost is low.
Owner:BEIJING SANYUAN FOOD

Immunochromatographic assay test paper for detecting staphylococcal enterotoxin B and preparation method thereof

The invention discloses an immune chromatographic indicator paper and making method of B-typed staphylococcus aureus enterotoxin, which comprises the following parts: sample pad 1, metal pad 2 with specific antibody mark colloidal gold probe of B-typed staphylococcus aureus enterotoxin in connection with one end of sample pad tightly, nitric fiber film (NC film) 3 in connection with the other end of metal pad tightly, water-absorbing pad 4 in connection with the other end of nitric fiber film tightly, wherein the nitric fiber film covers mutually separated detecting line 5 and quality control line 6, which is specific antibody of B-typed staphylococcus aureus enterotoxin and sheep-anti-rabbit lgG separately.
Owner:MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI

Rebuild golden staphylococcus enterotoxin N and preparation and application thereof

A recombinant Methicillin-resistant Staphylococcus aureus enterotoxin N belongs to a super antigen with SEQ ID NO.1 amino acid sequence, which is expressed by a recombination of a gene coding SEN from the Staphylococcus aureus and a plasmid vector, and a transformation to the proper host and is obtained a recombinant a highly purified SEN protein by affinity purification. The invention proves the recombinant protein has a typical super antigen activity better than SEC and can be applied in the preparation of activating the lymphocytes multiplication and inhibiting the tumor cell proliferation. The product is suitable for preparing the highly purified enterotoxin with the super antigen activity and exploiting super antigen agent. The invention has a wise design, purifies the target protein with affinity chromatography, has a simple process and a high purification speed.
Owner:ZHEJIANG UNIV

Method for detecting staphylococcus aureus enterotoxin by nanostructured composite metal

The invention discloses a method that detects Staphylococcus aureus enterotoxin by a composite nano metal structure, which comprises the following steps: (1) a substrate is chosen and cleaned, and a polystyrene nano-sphere layer is self-assembled on the substrate; (2) the produced self-assembled polystyrene nano-sphere layer is taken as a die, and a silver film and a gold film are vapor-deposited on the self-assembled layer through a vapor deposition method; (3) the self-assembled polystyrene nano-sphere layer is removed through a Lift-off technique, and the nano metal array structure is obtained after array transformation; (4) the nano metal layer is activated by adopting a non-directional covalent connection method, and a biological molecular film layer that resists SE sheep monoclonal antibodies IgG is formed on the surface of the nano metal structure; (5) extinction spectrum of the nano metal structure is extracted by a spectrograph, and an extinction spectrum peak before the biological combination is obtained; (6) a solution to be detected is dropped on the substrate surface and blow-dried after the reaction, and step (5) is repeated; (7) the extinction spectrum peaks that are obtained before and after step (6) are contrasted, thus determining whether the solution to be detected contains SE. The method that detects the Staphylococcus aureus enterotoxin with the composite nano metal structure does not need the purifying and the marking of the solution to be detected, and can be applied into the quick detection of SE or other toxins in the same type.
Owner:INST OF OPTICS & ELECTRONICS - CHINESE ACAD OF SCI

Staphylococcus aureus enterotoxin A nano antibody A13 and application and kit of nano antibody A13

The invention discloses a staphylococcus aureus enterotoxin A (SEA) nano antibody A13 and application and a kit of the nano antibody A13. The nano antibody has small relative molecular mass, strong stability and high yield, can specifically recognize SEA, and has wider application and stronger specificity than conventional monoclonal antibodies. The invention discloses the nano antibody, a gene sequence encoding the nano antibody, a method for producing the nano antibody and a kit using the nano antibody. The nano antibody can avoid binding with staphylococcus aureus surface protein A, shows high specificity, has good stability and small molecular weight, and can be produced on a large scale.
Owner:NORTHWEST A & F UNIV

Staphylococcal enterotoxin A chemiluminiscence enzyme-linked immunoassay detection kit

The invention discloses a staphylococcus aureus enterotoxin A chemiluminiscence enzyme-linked immunoassay detection kit. The kit contains a monoclonal antibody resisting staphylococcus aureus enterotoxin A, horseradish peroxidase marked detection antibody solution resisting staphylococcus aureus enterotoxin A, staphylococcus aureus enterotoxin A serial standard solution, wrapping solution, washing solution, closing solution, chemiluminiscence solution and a chemiluminiscence enzyme-linked plate. The staphylococcus aureus enterotoxin A chemiluminiscence enzyme-linked immunoassay detection kit has the advantages of being strong in specificity, high in sensitivity and good in repeatability and is suitable for monitoring diseases and detecting staphylococcus aureus enterotoxin A in food and blood in rapid quantitative mode.
Owner:FOURTH MILITARY MEDICAL UNIVERSITY

Prepn and application of recombinant staphylococcus aureus enterotoxin O

ActiveCN101045924ATypical superantigen activityGrowth inhibitionBacteriaDepsipeptidesAntigenNucleotide
The present invention provides process of preparing recombinant staphylococcus aureus enterotoxin O, as one kind of superantigen with the amino acid sequence as shown in SEQ ID No. 1. The present invention constructs one kind of recombinant plasmid for expression staphylococcus aureus enterotoxin O via recombining pGEX-4T-1 and the polynucleotide sequence of SEQ ID No. 1, and obtains initial fusion GST-SEO protein accounting for 15-25 % of total bacterial protein content. The present invention utilizes the recombinant staphylococcus aureus enterotoxin O with superantigen activity in promoting extracorporeal spleen lymphopoiesis and inhibiting extracorporeal tumor cell growth. It is proved that the recombinant staphylococcus aureus enterotoxin O has superantigen activity similar to that of SEC. The present invention is suitable for use in preparing high purity enterotoxin with superantigen activity and developing superantigen preparation.
Owner:HANGZHOU ENSHI GENE TECH DEV

Preparation method of recombination staphylococcus aureus enterotoxin C2

InactiveCN1786165ATypical superantigen activityFacilitate subsequent separation and purificationBacteriaDepsipeptidesAntigenSolubility
The invention offers recombination staphylococcus aureus enterotoxin C2(SEC2) making method. It can realize by the following steps: amplifying and preparing SEC2 gene; connecting SEC2 gene and pronucleus expression plasmid; transforming recombination plasmid to expression host to efficiently express; purifying recombination SEC2. The method efficiently expresses recombination SEC2; and it is solubility, and has no occlusion body. Its advantages are simple steps, and quick purifying speed. Compared with corresponding nature albumen, the gained recombination has the same super antigen and immunology activity.
Owner:ZHEJIANG UNIV

Method for preparing enterotoxin C2 protein

InactiveCN101457219AEfficient expressionFacilitate subsequent separation and purificationBacteria peptidesFermentationStaphylococcus cohniiWild type
The invention relates to a genetic engineering technique, especially to a method for preparing an enterotoxin C2 protein comprising the following steps: (1) amplifying a gene fragment which codes the golden yellow staphylococcus enterotoxin according to the conventional PCR by using the golden yellow staphylococcus genome as templates and enzyme sites with Nco I and Xho I and 5' terminal protective bases as primers, and connecting obtained an objective gene to a vector; (2) converting plasmids constructed by a subcloning technology to the bacillus coli, and inducing protein expression by using conventional method IPTG; (3) purifying the staphylococcus aureus enterotoxin C2 protein by using an affinity purification column combining metal ions. The enterotoxin C2 protein of the invention does not contain any induced excessive amino-acid residue, thereby remaining a completely biology activity as a wild-type SEC2 expressed by the golden yellow staphylococcus. Moreover the purity is more than 98 The method of the invention is simple and is easy to operate, and the purification speed and purity are obviously high.
Owner:SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI

Use of slaphylococcus aureus enterotoxins in preparing drugs for treating or preventing A1DS

An application of staphylococcus aureus enterotoxin in preparing the medicines for preventing and treating AIDS is disclosed. Said enterotoxin may be SEA, SEB, SEC1, SEC2, and SED. Its advantages are low dosage and high curative effect.
Owner:SHENYANG XIEHE GRP LTD

Staphylococcus aureus enterotoxin detection kit and preparation and use methods thereof

The invention discloses a staphylococcus aureus enterotoxin detection kit and preparation and use methods thereof; the kit includes staphylococcus aureus enterotoxin SEA and SEB specific antibodies and enzyme-labeled staphylococcus aureus enterotoxin SEA and SEB antibodies, has the characteristics of high specificity, high sensitivity, high precision, high accuracy and the like and can quickly detect melamine remaining in feeds and animal products.
Owner:HUAAN MAGNECH BIO TECH

Protein G staphylococcus aureus enterotoxin kit and preparation method thereof

InactiveCN105353129AIncrease profitReduce dosageMaterial analysisAbzymeStaphylococcus aureus enterotoxin B
The invention relates to a protein G staphylococcus aureus enterotoxin kit and a preparation method thereof. Protein G is adopted to preprocess an enzyme labeling plate, and quick and accurate detection on staphylococcus aureus enterotoxin A / B is realized by combining with an ELISA double-antibody sandwich method. The kit consists of the 96-hole enzyme labeling plate, a staphylococcus aureus enterotoxin A-resistant protein G recombinant protein monoclonal antibody, a staphylococcus aureus enterotoxin B-resistant monoclonal antibody, a staphylococcus aureus enterotoxin antibody enzyme labeling object containing a horseradish peroxidase label, a sample diluent, a cleaning solution and a stop buffer. The protein G staphylococcus aureus enterotoxin kit can quickly and effectively detect the residual level of tony red in a to-be-detected sample, and also has the characteristics of simple operation, good specificity, high sensitivity, and the like.
Owner:HUAAN MAGNECH BIO TECH

One group of aptamers for specifically recognizing staphylococcus aureus enterotoxin C1

The invention discloses one group of aptamers for specifically recognizing staphylococcus aureus enterotoxin C1, and belongs to the biological technical field of food safety. In order to overcome the defect of lacking aptamer of staphylococcus aureus enterotoxin C1 in the prior art, one group of aptamers having good affinity and specificity on the staphylococcus aureus enterotoxin C1 is obtained by 12 turns of repeated screening through SELEX (systematic evolution of ligands by exponential enrichment) technology and analysis and verification of affinity and specificity tests. The group of aptamers provides a specific and efficient recognition ligand for analyzing and detecting the staphylococcus aureus enterotoxin C1 in food or environment and provides a new selection for the existing method of detecting the staphylococcus aureus enterotoxin C1 through antibodies.
Owner:JIANGNAN UNIV

Staphylococcus aureus enterotoxin A nano-antibody A21, application and kit

The invention discloses a staphylococcus aureus enterotoxin A nano-antibody A21, application and a kit. The nano-antibody obtained by the invention has the advantages of small relative molecular mass,strong stability and high yield, can specifically recognize SEA, and has wider application and stronger specificity than a conventional monoclonal antibody. The invention discloses the nano-antibody,a gene sequence for encoding the nano-antibody, a method for producing the nano-antibody and a kit applying the antibody. The nano-antibody obtained by the invention can prevent from being combined with staphylococcus aureus surface protein A, shows higher specificity, has good stability and small molecular weight, and can be produced on a large scale.
Owner:NORTHWEST A & F UNIV

Staphylococcus aureus enterotoxin gene PCR (Polymerase Chain Reaction) parting detection kit and method

The invention relates to a gene parting detection kit for detecting staphylococcus aureus enterotoxin SEA, SEB, SEC and SEE by a PCR (Polymerase Chain Reaction) method as well as a method thereof, belonging to the field of biological detection reagents. The kit comprises amplification reaction liquid, parting reaction liquids A, B, C and E, Taq enzyme, ddH2o, positive standard product of SEA, SEB, SEC and SEE, wherein the parting reaction liquid A contains SEA primers: SEA-F and SEA-R; the parting reaction liquid B contains SEB primers: SEB-F and SEB-R; the parting reaction liquid C contains SEC primers: SEC-F and SEC-R; the parting reaction liquid E contains SEE primers: SEE-F and SEE-R. The detection method comprises the steps of: extracting bacteria DNA, performing parting detection on the enterotoxin SEA, SEB, SEC and SEE genes by using the parting primers designed in the invention under the same PCR instrument and the same condition, and displaying the result via electrophoresis. The detection is rapid, accurate, high in sensitivity and low in cost.
Owner:长沙市疾病预防控制中心

Colloidal gold test strip for simultaneous detection of five staphylococcus aureus enterotoxins and preparation method thereof

The invention provides a colloidal gold test strip for simultaneous detection of five staphylococcus aureus enterotoxins A, B, C, D and E, and a preparation method thereof, belonging to the technical field of immunoassay. The invention discloses preparation and screening of sandwiched ELISA antibody pairs against the five enterotoxins, and the colloidal gold test strip for simultaneous detection of the five enterotoxins and the preparation method thereof. The test strip is composed of a sample pad, a cellulose nitrate film on which five test lines and one quality control line are sprayed, a water-absorbing pad and a PVC base plate. The five test lines respectively coat capture antibodies corresponding to enterotoxin E, D, C, B and A from front to back, and the quality control line coats a goat anti-mouse IgG secondary antibody. Under the condition of existence of a target object, colloidal gold detection antibodies corresponding to the five gold nanoparticle-labeled enterotoxins are respectively bonded with the target object to form a sandwich structure and develop a color at corresponding test lines. The test strip can realize simultaneous detection of the five enterotoxins in food; a test method is simple, fast and sensitive and has good specificity; and minimum naked-eye detection limits of the five enterotoxins A, B, C, D and E are 5 ng / mL, 5 ng / mL, 5 ng / mL, 2.5 ng / mL and 10 ng / mL.
Owner:JIANGNAN UNIV

Nucleic acid aptamer S3 of Staphylococcus aureus enterotoxin A and application thereof

The invention relates to a nucleic acid aptamer S3 of Staphylococcus aureus enterotoxin A and application thereof. The nucleic acid aptamer S3 of Staphylococcus aureus enterotoxin A has a unique stem loop structure and can realize structural reconstruction like chemical modification of FITC, an amino group, biotin and digoxin and truncation, prolongation or partial base substitution. The nucleic acid aptamer S3 can realize high-affinity and high-specificity bonding with Staphylococcus aureus enterotoxin A, inhibits superantigen activity of Staphylococcus aureus enterotoxin A in in-vitro experiments and has the advantages of no toxicity, small molecular weight, good permeability and easiness in synthesis and marking. The nucleic acid aptamer S3 of Staphylococcus aureus enterotoxin A can be applied to non-disease diagnosis and treatment methods for separation and enrichment or analysis and detection of Staphylococcus aureus enterotoxin A and to treatment of infection with Staphylococcus aureus.
Owner:FUZHOU GENERAL HOSPITAL OF NANJING MILITARY COMMAND P L A

PCR (Polymerase Chain Reaction) synchronization detection kit for A and B genes of staphylococcus aureus enterotoxin

The invention discloses a PCR (Polymerase Chain Reaction) synchronization detection primer and kit as well as detection method for A and B genes of staphylococcus aureus enterotoxin. A nucleotide sequence of the synchronization detection primer provided by the invention is as shown in SEQ ID No.1 and 2. The invention also provides the PCR detection kit containing the primer. The detection kit provided by the invention can be used for accurately and sensitively detecting the A and B genes of the staphylococcus aureus enterotoxin in food; the lowest detection concentration of DNA (Deoxyribonucleic acid) is 3.58ng; the detection kit has non-cross reaction with other bacteria and has good specificity; simultaneously, the pretreatment process of the sample is simple and consumes little time; and the detection kit can be used for simultaneously detecting a large number of samples and is low in cost.
Owner:BEIJING SANYUAN FOOD

Method for predicting staphylococcus aureus growth and toxin production in milk

The invention discloses a method for predicting staphylococcus aureus growth and toxin production in milk, which relates to a method for predicting staphylococcus aureus growth and toxin production through the principle of predictive microbiology. The invention solves the problems that the method for testing the number of staphylococcus aureus and staphylococcus aureus enterotoxin in milk is complex to operate, and the test time is long. In the method: first, the maximum growth rate is obtained according to 7.1917 * 10-5* T2 +0.022782* T-0.32889; second, the bacterial count is obtained according to log N (t) = A + C (exp (-exp (-y (t-M)))); third, the time corresponding to the bacterial count 106.4cfu / mL is combined with F=0.0018543 * T2-0.050277* T +0.32629 to obtain the toxin production speed rate, that is, the prediction of the staphylococcus aureus growth and toxin production is realized. The invention has the advantages of simple operation and short test time.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Fusion immunotoxin ML-L-SEC2 and gene and its preparation

The invention relates to a new type of anti-human epidermal growth factor receptor HER-2- Staphylococcus aureus enterotoxin C2 coalesce gene ml-l-sec2 of immunotoxin ML-L-SEC2 and its preparation, in which, there is a base sequence in the table SEQ ID No:1 and protein sequence in the table SEQ ID No:2. The invention provides a method for constructing the confluens immunotoxin B-L-SEC2 with single-chain antibody of anti - HER-2 elements and SEC2 via the link of short peptide, and expresses the confluence immunotoxin protein in the coliform bacterium via expression vector pET-32a.
Owner:SHENYANG INST OF APPL ECOLOGY CHINESE ACAD OF SCI

Aptamer C202 of staphylococcus aureus enterotoxin C2 as well as screening method and applications thereof

The invention relates to aptamer C202 of staphylococcus aureus enterotoxin C2 as well as a screening method and applications of the aptamer C202. The aptamer C202 has the sequence as follows: AGGGCCGAGCTCACTTGTCACGGGCACCCTAACTGGGAGGAGGCAGGATAACACCGCCGGCACAATTGTGC. The screening method comprises the step of carrying out screening from an ssDNA library through staphylococcus aureus enterotoxin C2 magnetic beads based on the in-vitro SELEX screening technology of the aptamer and by taking carboxylic magnetic beads as the solid-phase medium and staphylococcus aureus enterotoxin C2 as the target, and thus the aptamer in specific binding with the staphylococcus aureus enterotoxin C2 is obtained. The aptamer C202 provided by the invention can be bond to the staphylococcus aureus enterotoxin C2 with high affinity and high specificity.
Owner:FUZHOU GENERAL HOSPITAL OF NANJING MILITARY COMMAND P L A

Enhanced anti-tumor fusion protein, preparation method and use thereof

The invention discloses an enhanced anti-tumor fusion protein, a preparation method and use thereof. The fusion protein includes at least two of a costimulatory molecule B7.1 that induces and activates T cells, a costimulatory molecule B7.2 that induces and activates the T cells, and a superantigen Staphylococcus aureus enterotoxin A. The fusion protein of the present invention constructs at leasttwo of B7.1, B7.2 and SEA into the fusion protein, and exerts the superimposed amplification effect. The biological activity is far more than that of a single source protein, the T cells are inducedand activated to kill tumors, the T cells secrets cytokines such as tumor necrosis factor alpha (TNF-alpha) and granzymes and induces the cancer cells as target cells to produce Fas and the like to cause cancer cells to apoptosis, The experiments have shown that each of the fusion proteins of the present invention has the significant killing effect on various cancers and solid tumors.
Owner:孙嘉琳 +1

Portable staphylococcus detection method and device based on micro-fluidic paper chip

The invention discloses a portable staphylococcus detection method and device based on a micro-fluidic paper chip and belongs to the field of biomedical detection. The method comprises the following steps of: controlling a sample solution to flow into a culture and color development unit, and then enabling a staphylococcus aureus enterotoxin A specific antibody solution to flow into the culture and color development unit; flushing an unattached redundant primary antibody solution in the culture and color development unit with a PBS buffer solution; enabling a peroxidase anti-enterotoxin A specific antibody solution to flow into the culture and color development unit; flushing an unattached redundant secondary antibody solution in the culture and color development unit with the PBS buffer solution again; enabling a peroxide substrate OPD solution to flow into the culture and color development unit; and enabling an enzyme on the surface of the secondary antibody combined with the surface of staphylococcus aureus to decompose the substrate to generate a colored reaction product, and enabling a stop solution to destroy peroxidase after completing the reaction,so as to make the enzyme-linked substrate not to be decomposed any more. According to the method and device of the invention, a microfluidic paper-based chip technology is combined with an ELISA detection technology, and a concentration value can be obtained by taking a picture of a color developing area by a mobile phone and then carrying out HSV analysis.
Owner:JIANGSU UNIV

Method for preparing dual-regulated oncolytic adenovirus for expressed superantigen gene of targeted prostate tumor

The invention relates to an expressed superantigen gene of targeted prostate tumor, in particular to a method for preparing dual-regulated oncolytic adenovirus for the expressed superantigen gene of the targeted prostate tumor, and belongs to the technical field of gene therapy. The preparation method comprises the following steps of: by applying the genetic engineering technology, cloning staphylococcus aureus enterotoxin A genes into an oncolytic adenovirus vector so as to limit the proliferation and expression of the genes in prostate tumor cells only and fulfill the aim of killing target prostate tumor cells; and regulating a tumor specific proliferous adenovirus vector by using a prostate specific antigen promoter and a telomerase reverse transcriptase promoter, carrying the staphylococcus aureus enterotoxin A gene fragment, and naming as SG504-SEA. The expressed superantigen gene has the advantages of specific proliferation in tumor cells and high cytotoxic T lymphocyte irritating capacity.
Owner:韩从辉

Recombinant Staphylococcus aureus enterotoxin G oral preparation and use

The invention provides a recombinant staphylococcus aureus enterotoxin G oral preparation which has an amino acid sequence of SEQ ID NO.1 and also comprises excipients in medicine or carriers allowed by the preparation. By the experiment on the Caco-2 monolayer cell trans-membrane transport, the preparation of the invention proves that the proteins can enter the general blood circulation from intestinal epithelial cells in the form of complete molecules and keep promoting the splenic lymphocyte proliferation and preventing the superantigen activity for the growth of tumor cells, and can be applied to the preparation of drugs for curing the malignant tumor and other serious complications.
Owner:ZHEJIANG UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More