56 results about "Species specific primers" patented technology

The present invention relates to DNA-based methods for universal bacterial detection, for specific detection of the common bacterial pathogens Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Proteus mirabilis, Streptococcus pneumoniae, Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis, Staphylococcus saprophyticus, Streptococcus pyogenes, Haemophilus influenzae and Moraxella catarrhalis as well as for specific detection of commonly encountered and clinically relevant bacterial antibiotic resistance genes directly from clinical specimens or, alternatively, from a bacterial colony. The above bacterial species can account for as much as 80% of bacterial pathogens isolated in routine microbiology laboratories. The core of this invention consists primarily of the DNA sequences from all species-specific genomic DNA fragments selected by hybridization from genomic libraries or, alternatively, selected from data banks as well as any oligonucleotide sequences derived from these sequences which can be used as probes or amplification primers for PCR or any other nucleic acid amplification methods. This invention also includes DNA sequences from the selected clinically relevant antibiotic resistance genes. With these methods, bacteria can be detected (universal primers and / or probes) and identified (species-specific primers and / or probes) directly from the clinical specimens or from an isolated bacterial colony. Bacteria are further evaluated for their putative susceptibility to antibiotics by resistance gene detection (antibiotic resistance gene specific primers and / or probes). Diagnostic kits for the detection of the presence, for the bacterial identification of the above-mentioned bacterial species and for the detection of antibiotic resistance genes are also claimed. These kits for the rapid (one hour or less) and accurate diagnosis of bacterial infections and antibiotic resistance will gradually replace conventional methods currently used in clinical microbiology laboratories for routine diagnosis. They should provide tools to clinicians to help prescribe promptly optimal treatments when necessary. Consequently, these tests should contribute to saving human lives, rationalizing treatment, reducing the development of antibiotic resistance and avoid unnecessary hospitalizations.

The invention relates to a conjoint analysis method for estimating the DNA abundance of fishes based on an environment DNA technology. The conjoint analysis method includes the steps that the total DNA abundance of the fishes is acquired through timed and quantified PCR; the species composition proportion of the fishes is acquired through 454 GS-FLX Titanium sequencing analysis; conjoint analysis of target species is performed through sequencing data and timed and quantified PCR data; a relative distribution diagram of mitochondrial DNA of the fishes in an environment is drawn through sufer 8.0 software. Based on the environment DNA identification technology, weather species exist and how many species exist can be analyzed just by collecting water samples without depending on fish species capturing, a sampling method is simple, and fish resources can be protected to the maximum degree; meanwhile, for some species which are rarely distributed and difficult to capture, the method is still more effective than traditional fishing investigation, the method can effectively solve the problem that effective species specificity primers are difficult to obtain when multiple closely related species exist in samples, and NDA abundance information of all species can be known just by conducting experiment once respectively through the two technologies.

Dermatophytes which belong to one of the three genera Epidermophyton, Trichophyton and Microsporum are the main cause of fungal infections of skin, hair and nails. Traditional diagnostic procedures consist of microscopy and culture, but due to the slow growth rate of dermatophytes typically two to four weeks are needed before a final diagnosis is obtained. The present invention is a rapid DNA extraction method extracting nucleic acids from fungi (e.g. dermatophytes and other pathogenic fungi) which can be performed from directly on hair, nail or skin specimens from humans, from naturally or experimentally infected animals or from cultured fungal colonies for the use in PCR amplification and detection assays. The present invention also includes specific primer sets for detection of any dermatophyte and for species specific detection of Trichophyton rubrum and Epidermophyton floccosum by PCR and a kit for diagnosing fungal infections.

The invention provides a PCR identification method derived from eucaryote for Chinese traditional medicine and traditional Chinese medicinal materials. PCR augmentation is processed on DNA samples to obtain augmentation production according to a species-specific primer, wherein, the species-specific primer is designed according to a SINE sequence of eukaryotic genomes. The DNA samples are extracted from the Chinese traditional medicine and traditional Chinese medicinal materials, in particular from the further processing type Chinese traditional medicine. Species categories of eukaryotic species in the further processing type Chinese traditional medicine are estimated by analyzing the augmentation production, and the truth of the identified samples is further estimated. The PCR identification method is suitable for Chinese traditional medicine and traditional Chinese medicinal materials, is particularly suitable for the processing type Chinese traditional medicine, especially for the Chinese traditional medicine which is with extremely little DNA content and extremely short segment due to the further processing. The identification method has the advantages of simple operation, rapidness and sensitivity, low cost and effective truth identification of the Chinese traditional medicine and the traditional Chinese medicinal materials.

The invention relates to a method for designing a species specific primer for detecting the species with known genome information in a microbial community and a method for measuring the bacterium content. The designing method is based on a species specific primer of some species with known genome information in a microbial community. The method comprises the following steps: cloning and sequencing a nearly full-length ribosomal gene library; carrying out biological information analysis (BLAST, etc.) to determine the species in a bacterial community and relative abundance of the species; inquiring the species with known genome sequences; based on a PRIMER-BLAST tool, designing a species specific primer, and detecting the specificity of the primer. The bacterium content is measured through a QPCR method: the provided species specific primer is used to quantitatively measure the content of corresponding species in a microbial community. The provided method for measuring the content of known microbes in a microbial community can trace and inspect the number change of some important microbial species in an important biological process (liquor fermentation, for example) in the species level. The provided method can measure the copy number of non-ribosomal gene sequence of species specificity in some microbial genome and cannot obtain the specific number of cells of species in a microbial community.

Belonging to the technical field of animal origin component molecular detection, the invention provides a multiplex PCR detection kit for fox origin component identification and identification of fox, rabbit and dog components in animal products. The kit provided by the invention includes fox, rabbit, dog and other species-specific primers, a reaction reagent, and positive control and blank control. The fox specific primer is a primer pair able to specifically amplify the nucleotide sequence shown as SEQ ID No.1. The primer provided by the invention is employed to amplify sample DNA, and the PCR amplification product is analyzed to determine whether the sample contains fox species origin ingredients, and at the same time can identify whether rabbit origin or dog origin components are mixed, thus providing means for molecular identification of fur products. In addition, by means of multiplex PCR detection, fox origin, rabbit origin and dog origin components can be identified at one time. The invention establishes an effective method for identification of meat adulteration, fur and feed components. The method and kit have the advantages of simplicity, fastness, comprehensiveness, strong specificity, low cost, and wide applicability.

The invention relates to an identification method for bolting character of radish based on FLC gene, belonging to the biotechnology field. In the invention, DNA differences of gene FLC sequence closely related to bolting and blossoming in early and late bolting character radish varieties are taken as basis to design two pairs of species-specific primers NauFLC-F1 / NauFLC-R1 and NauFLC-F2 / NauFLC-R2, then PCR technology is used to carry out FLC gene specific amplification on material genomic DNA, and the tested materials are judged to be either early bolting type or late bolting type according to the electrophoresis results rapidly and correctly. The method can be effectively used for identifying the bolting character of radish germplasm materials, and can greatly quicken the breeding process of the good strains of the spring radish bolting resistance rapidly, correctly and efficiently.

The invention relates to a quick qualitative and quantitative measuring method of fermented lactobacillus in probiotic milk products. Aiming at fermented lactobacillus in probiotic milk products, themethod designs a species specific primer of a 16S rRNA gene sequence of fermented lactobacillus by self, the species specific primer PCR reaction and real-time fluorescent quantitative PCR reaction ofthe primer is carried out to establish the simple, convenient, quick and accurate qualitative and quantitative measuring method of fermented lactobacillus in probiotic milk products by agarose gel electrophoresis pattern analysis and real-time fluorescent quantitative PCR pattern analysis.

The invention discloses a multiple fluorescent PCR method and kit for identifying animal-derived components. The method comprises the following steps: extracting DNA in a sample as a template, carrying out multiplex PCR amplification by utilizing a plurality of pairs of designed species-specific primers, carrying out high-resolution melting curve analysis on a multiplex PCR amplification product,and judging animal-derived components contained in the sample according to a position of a melting peak of the amplified product. The method is easy to operate, short in detection period, high in specificity and reliable in detection result; the problem of pollution caused by tube opening can be avoided; and large-scale sample detection is achieved.

Dental caries is a polymicrobial infectious disease. Of the hundreds of bacteria present in the biofilms coating teeth, the Streptococcus mutans (S. mutans) remain strongly linked to caries and dental disease. Streptococcus sanguinis (S. sanguinis) may serve a protective or antagonistic role against the cariogenic bacterium S. mutans. In the present invention, exemplary sets of species-specific PCR primers are provided for the identification and quantification of S. mutans and of S. sanguinis in clinical samples, including the simultaneous and sensitive analysis of both bacterial species. Assays, kits and methods for determining the presence and amount of S. mutans and / or S. sanguinis are provided. Oligonucleotide probes and primers for use in the assays, kits and methods are described. Assays and methods for determining and evaluating an individual's oral bacteria, risk for caries, and effects of prevention and treatment modalities, are provided.

Targeted sequencing of genetic regions that differ between two DNA preparations uses genomic fragment enrichment. This method can be used to study genetic variation among closely related species and microbial communities, particularly for identifying sources of fecal pollution.

The inventions provides a method for identifying a target virus in an infected subject comprising the steps of designing a pair of degenerate primers corresponding to highly conserved regions of the target virus; designing a pair of species-specific primers according to highly variable sequences within the conserved regions of the target virus; preparing the species-specific probes according to the larger sequence variations within the conserved regions of the target virus, which are amplified with the species-specific primers as obtained; preparing a test sample by amplifying total nucleic acid of the infected subject with the degenerate primers as obtained; contacting the test sample with the species-specific probes as obtained; and detecting a hybridization between the species-specific probe and the test sample, wherein the hybridization indicates the target virus is identified in the infected subject. The primers and probes for detecting a garget virus are also provided.

A method for simultaneous detection and identification of Bacillus anthracis, Yersinia pestis and Francisella tularensis, in a single real time PCR assay using species-specific primers and Taqman MGB probes. Also, a kit for the diagnosis of bacterial bioterrorism agents. In addition, an infection-free control plasmid to verify the result of the real time PCR analysis method.

The invention provides a novel PCR (Polymerase Chain Reaction) primer (16s 200) for identifying or assisting in identifying freshwater fish species. A nucleotide sequence of the primer is SEQ ID NO.1 in a sequence table. The PCR primer is applied to eDNA metabolism coding of a fish mitochondrial DNA sequence. The PCR primer is adopted to perform PCR amplification on eDNA in a water body, based on a high-throughput sequencing method, the problem that an effective species specific primer is difficult to obtain under the condition that various closely-related species exist in the water body can be effectively solved, and based on an environmental DNA monitoring technology, an effective technical support is provided for taxonomy research and diversity protection of fishes. The method for identifying the freshwater fish species by using the PCR primer has the advantages of short consumed time, simplicity and convenience in operation, high specificity and the like.

Belonging to the technical field of animal origin component molecular detection, the invention provides a multiplex PCR detection kit for mink origin component identification and identification of mink, rabbit and dog components in animal products. The kit provided by the invention includes mink, rabbit, dog and other species-specific primers, a reaction reagent, and positive control and blank control. The mink specific primer is a primer pair able to specifically amplify the nucleotide sequence shown as SEQ ID No.1. The primer provided by the invention is employed to amplify sample DNA, and the PCR amplification product is analyzed to determine whether the sample contains mink species origin ingredients, and at the same time the kit can identify whether rabbit origin or dog origin components are mixed, thus providing means for molecular identification of fur products. In addition, by means of multiplex PCR detection, mink origin, rabbit origin and dog origin components can be identified at one time. The invention establishes an effective method for identification of meat and fur adulteration and feed components. The method and kit have the advantages of simplicity, fastness, comprehensiveness, strong specificity, low cost, and wide applicability.

The invention relates to a species-specific PCR method for rapidly identifying ten sea cucumber species, and belongs to the molecular biology field. The method comprises the following steps: respectively designing species-specific primers of the ten species of sea cucumber through sequence alignment by treating mitochondrial 16SrRNA gene of the ten species of sea cucumber as target gene, extracting sea cucumber mitochondrial gene, carrying out specific PCR amplification detection, determining the sea cucumber species comprising Actinopygamauritiana, Stichopusnaso, Cucumariafrondosa, Holothuriaedulis, Holothuriaatra, Holothuriaflavomaculata, Holothuriamammata, Holothuriabacilla, Holothurianotabilis and Holothuriamoebii according to the existence or inexistence of a PCR amplification band, carrying out specific PCR amplification to respectively obtain 274bp, 276bp, 264bp, 275bp, 270bp, 273bp, 274bp, 276bp, 276bp and 270bp specific fragments.

The invention discloses a method for rapid identification of specific primers by specific primers. Through sequencing COI gene fragment of Carpomya vesuviana Costa mtDNA and with the application of a species-specific primer PCR (SS-PCR) and agarose gel electrophoresis (AGE) technology, a pair of Carpomya vesuviana Costa specific primers is screened out. The specific primers' sequences are respectively as follows: primer sequence of CarF is CTCAACTAAATTATTCCCCAGCA; primer sequence of CarR is GGGTATCAATGCACAAATCCA. According to morphological similarity of Carpomya vesuviana Costa's egg, larva and pupa to other fruit flies and in allusion to common fruit flies including citrus fruit fly, melon fly, bactrocera tau, bactrocera correcta and bactrocera zonata as a negative control for detection of primers specificity, it is proved that the primers specificity to Carpomya vesuviana Costa helps greatly shorten identification period of Carpomya vesuviana Costa and has wide practicality.

The present invention describes a method, based on a semi-nested polymerase chain reaction (PCR), for the detection and identification of ten clinically relevant Candida species. The method involves a first PCR amplification of the internal transcribed spacer region ITS2 of fungal ribosomal RNA, followed by a second PCR reaction with a species-specific primer. Custom-designed primers are provided.

The invention discloses a method for detecting the content of bovine derived components in a meat product based on a digital PCR (Polymerase Chain Reaction) method. The method is characterized by screening single-copy gene sequences from genomic sequences of 15 kinds of animals by applying a bioinformatics means, and designing an internal reference primer and a bovine derived species specific primer. According to the method disclosed by the invention, the content of the bovine derived components in the meat product is absolutely and quantitatively analyzed based on a droplet digital PCR technology, standard products are not required, a standard curve is not required to be established, and the defect that a part of standard products cannot be easily obtained is remedied; meanwhile, magnitude deviation caused by technological difference between the standard products and samples is also effectively avoided, so that internal reference genes are applied to correct the percentage content ofthe bovine derived species specific primer, and true and believable food adulteration numerical value can be obtained; the method is capable of completing identification work on the content of the bovine derived components within 3 hours and has the characteristics of simpleness, practicability, high efficiency, sensitivity and the like, and a wide prospect is opened up for identifying quantitative adulteration of animal derived components.

The invention provides a multiplex PCR detection kit for rapidly detecting meat-derived foods. The multiplex PCR detection kit is mediated by a 'public primer', can identify mouse, fox, duck and sheepcomponents in foods or animal products, and belongs to the technical field of molecular detection of animal-derived components. The kit provided by the invention discloses specific primer pairs of four species mouse, fox, duck and sheep, wherein a sheep-specific primer is a primer pair capable of specifically amplifying a nucleotide sequence shown in SEQ ID No. 1; the primer of the invention canbe adopted to amplify a sample DNA; a PCR amplification product is analyzed to determine whether the sample contains sheep-derived components; moreover, whether mouse-derived components, fox-derived components and duck-derived components are doped can be identified; in addition, the mouse-derived components, the fox-derived components, the duck-derived components and sheep-derived components can be identified at one time by multiplex PCR detection. The kit provided by the invention has relatively high sensitivity, reproducibility, simple operation, relatively low cost and wide applicability, and can be used for screening and identification detection of meat sources of mixed meat products.

The invention provides a specific primer, a kit and an identification method for identifying donkey-derived components. A large number of primers are designed based on CYT B and COX-1 genes of a donkey, and are screened and researched to screen out a species-specific primer; and the primer is used for identifying the donkey-derived components in a mixture to be detected. The specific primer, the kit and the identification method provided by the invention can accurately distinguish the donkey-derived components from other adulterants, have a PCR amplification product of only 50-150bp and smallmolecular weight, ensure identification of the donkey-derived components in a large number of mixtures within a short time, and can obtain accurate, stable, reliable and highly sensitive identification results.