Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for rapid identification of Carpomya vesuviana Costa by specific primers

A technology of specific primers and Bactrocera cerevisiae is applied in the field of quarantine pest detection to shorten the identification cycle

Inactive Publication Date: 2017-06-30
四川科劲生物科技有限公司
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the occurrence of Bacteralis, in addition to morphological identification, there is currently no set of PCR identification technology for Bacteralis-specific primers at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapid identification of Carpomya vesuviana Costa by specific primers
  • Method for rapid identification of Carpomya vesuviana Costa by specific primers
  • Method for rapid identification of Carpomya vesuviana Costa by specific primers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Method for rapid identification of Bactrocera jujube using specific primers

[0034] Using specific primers to quickly identify Bactrocera jujube, the main inventions are as follows:

[0035] (1) Using species-specific primer PCR (SS-PCR) and agarose gel electrophoresis (AGE) techniques, a pair of specific primers for fruit fly was screened out. SS-PCR was carried out on a quantitative gradient PCR machine (Biometra), reaction system: 10mmol / L 10×Buffer, 0.25mmol / LMg2+, 0.25mmol / LdNTP, each of the upstream and downstream primers was 0.1umol / L, 1UTaq enzyme (Takara), template DNA 1μL , Add water to a total volume of 25μL, the reaction conditions are 94℃ / 5min, 95℃ / 40s, 57℃ / 30s, 72℃ / 1min, 33 cycles, and finally 72℃ extension for 5min; respectively extract 5μL of PCR products in brominated Run electrophoresis on a 1.5% agar gel multifunctional electrophoresis instrument for 30 minutes (90V), and check the results on a digital image analyzer to observe the size and wi...

Embodiment 2

[0051] Example 2: DNA quality inspection

[0052] The DNA extraction quality of Bactrocera jujube was checked with the primer pair can-F / can-R. This primer pair is a universal primer specially used to check the quality of the template DNA of fruit flies. The quantitative gradient PCR instrument reaction system includes 10×Buffer (without Mg2+) 2.5μL, 25mmolMg2+2.5μL, 2.5mmoldNTP2.5μL, 10μmol upstream and downstream 1μL each of primers, 1UTaq enzyme, 1μL template DNA, add water to a total volume of 25μL, reaction conditions are 94℃ / 5min, 95℃ / 40s, 55℃ / 30s, 72℃ / 1min, 30 cycles, and finally 72℃ extension for 7min. After the PCR reaction is over, extract 5μL of the PCR products respectively and electrophoresis on a 1.5% agar gel multifunctional electrophoresis instrument containing ingot bromide for 30 minutes (90V), the detection results on the digital image analyzer, observe the size and width of the amplified band, The exact DNA concentration is determined by a nucleic acid protei...

Embodiment 3

[0054] Example 3: SS-PCR identification of fruit fly

[0055] Primer specificity verification: The present invention obtains 1 pair of specific primers that can specifically identify the fruit fly by screening. In order to check the specificity of the primer under the conventional PCR method, in addition to the fruit fly to be identified, the experimental materials also The other five species of fruit flies with high homology, including Bactrocera dorsalis, Bactrocera guava, Bactrocera cucurbita, Bactrocera pratensis, and Peach fruit flies, were subjected to routine PCR reactions to screen and obtain the specific identification of fruit flies. Primers CarF / CarR, conventional PCR amplification products are subjected to agarose gel electrophoresis, see attached figure 2 . By the attachment figure 2 It can be seen that, except for the specific amplified band at 205bp, the negative control and the other five species of fruit flies have no specific target fragments, which proves tha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapid identification of specific primers by specific primers. Through sequencing COI gene fragment of Carpomya vesuviana Costa mtDNA and with the application of a species-specific primer PCR (SS-PCR) and agarose gel electrophoresis (AGE) technology, a pair of Carpomya vesuviana Costa specific primers is screened out. The specific primers' sequences are respectively as follows: primer sequence of CarF is CTCAACTAAATTATTCCCCAGCA; primer sequence of CarR is GGGTATCAATGCACAAATCCA. According to morphological similarity of Carpomya vesuviana Costa's egg, larva and pupa to other fruit flies and in allusion to common fruit flies including citrus fruit fly, melon fly, bactrocera tau, bactrocera correcta and bactrocera zonata as a negative control for detection of primers specificity, it is proved that the primers specificity to Carpomya vesuviana Costa helps greatly shorten identification period of Carpomya vesuviana Costa and has wide practicality.

Description

Technical field [0001] The present invention belongs to the field of quarantine pest detection. Specifically, the present invention relates to the technical field of rapid identification of jujube fruit flies using specific primers. Background technique [0002] The date fruit fly (Carpomyavesuviana Costa) is a major invasive quarantine pest, belonging to the Diptera Diptera Tephritidae family Trypetinae fruit fly family Trypetini Carpomya Costa, native to India, is an important plant of the genus Jujube Fruit-boring pests have been included in the "List of Entry Plant Quarantine Pests" in my country. Carpomyavesuviana Costa, a major quarantine pest, was discovered in Turpan in 2007, causing devastating losses to the jujube industry in the region, and the epidemic has a tendency to spread to other regions (Zhang Runzhi et al., 2007; Adili Shatar Et al., 2008). With the rapid development of China's economy, both domestic and international business trade and personnel exchanges ar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6888
Inventor 林丹
Owner 四川科劲生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com