Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for rapid identification of Bacteralis jujube by using specific primers

A technology of specific primers and Bactrocera cerevisiae, applied in biochemical equipment and methods, microbial measurement/inspection, etc., to shorten the identification cycle

Inactive Publication Date: 2016-01-20
XINJIANG AGRI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the occurrence of Bacteralis, in addition to morphological identification, there is currently no set of PCR identification technology for Bacteralis-specific primers at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for rapid identification of Bacteralis jujube by using specific primers
  • A method for rapid identification of Bacteralis jujube by using specific primers
  • A method for rapid identification of Bacteralis jujube by using specific primers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Method for rapid identification of Bactrocera jujube using specific primers

[0032] Using specific primers to quickly identify Bactrocera jujube, the main inventions are as follows:

[0033] (1) Using species-specific primer PCR (SS-PCR) and agarose gel electrophoresis (AGE) techniques, a pair of specific primers for fruit fly was screened out. SS-PCR was carried out on a quantitative gradient PCR instrument (Biometra), reaction system: 10mmol / L10×Buffer, 0.25mmol / LMg 2+ , 0.25mmol / L dNTP, 0.1umol / L upstream and downstream primers, 1UTaq enzyme (Takara), template DNA 1μL, add water to a total volume of 25μL, reaction conditions are 94℃ / 5min, 95℃ / 40s, 57℃ / 30s, 72℃ / 1min, 33 cycles, and finally extended at 72°C for 5min; respectively extract 5μL of PCR product and electrophoresis on a 1.5% agar gel multifunctional electrophoresis instrument containing ingot bromide for 30min (90V), and observe the result on digital image analyzer. Amplify the size and width of the...

Embodiment 2

[0054] Example 2: DNA quality inspection

[0055] The DNA extraction quality of Bactrocera jujube was checked with the primer pair can-F / can-R. This primer pair is a universal primer specially used to check the quality of the template DNA of fruit fly insects. The reaction system of the quantitative gradient PCR instrument includes 10×Buffer (without Mg 2+ ) 2.5μL, 25mmolMg 2+ 2.5μL, 2.5mmoldNTP 2.5μL, 10μmol upstream and downstream primers, 1μL each, 1UTaq enzyme, 1μL template DNA, add water to a total volume of 25μL, reaction conditions are 94℃ / 5min, 95℃ / 40s, 55℃ / 30s, 72℃ / 1min, 30 cycles, the final extension at 72°C for 7 minutes. After the PCR reaction is over, extract 5μL of the PCR products respectively and electrophoresis on a 1.5% agar gel multifunctional electrophoresis instrument containing ingot bromide for 30 minutes (90V), the detection results on the digital image analyzer, observe the size and width of the amplified band, The exact DNA concentration is determined b...

Embodiment 3

[0057] Example 3: SS-PCR identification of fruit fly

[0058] Primer specificity verification: The present invention obtains 1 pair of specific primers that can specifically identify the fruit fly by screening. In order to check the specificity of the primer under the conventional PCR method, in addition to the fruit fly to be identified, the experimental materials also The other five species of fruit flies with high homology, including Bactrocera dorsalis, Bactrocera guava, Bactrocera cucurbita, Bactrocera pratensis, and Peach fruit flies, were subjected to routine PCR reactions to screen and obtain the specific identification of fruit flies. Primers CarF / CarR, conventional PCR amplification products are subjected to agarose gel electrophoresis, see attached figure 2 . By the attachment figure 2 It can be seen that, except for the specific amplified band at 205bp, the negative control and the other five species of fruit flies have no specific target fragments, which proves tha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapidly identifying Carpomya vesuviana Costa by adopting specific primers. According to the method, a pair of specific primers for the Carpomya vesuviana Costa, namely CarF and CarR, are screened through sequencing COI gene fragments of mtDNA (mitochondrial Deoxyribonucleic Acid) of the Carpomya vesuviana Costa and using species-specific primer PCR (Polymerase Chain Reaction) (SS-PCR) and agarose gel electrophoresis (AGE) technologies, wherein the sequence of the CarF is CTCAACTAAATTATTCCCCAGCA, and the sequence of the CarR is GGGTATCAATGCACAAATCCA; and according to the proximity of the eggs, larvae and pupae of the Carpomya vesuviana Costa with the forms of those of other tephritidae pests, the primers designed in the method serve as a negative reference for the primer specificity testing of common tephritidae pests, such as bactrocera dorsalis, bactrocera cucurbitae, bactrocera tau, bactrocera correcta and bactrocera zonata and are proved to have specificity to the Carpomya vesuviana Costa, and the identifying cycle of the Carpomya vesuviana Costa is shortened greatly, so that the method has wide practicability.

Description

Invention field [0001] The present invention belongs to the field of quarantine pest detection. Specifically, the present invention relates to the technical field of rapid identification of jujube fruit flies using specific primers. Background technique [0002] Date fruit fly (Carpomyavesuviana Costa) is a major invasive quarantine pest, belonging to the Diptera Diptera Tephritidae family Trypetinae fruit fly family Trypetini Carpomya Costa, native to India, is an important plant of the genus Jujube Fruit-boring pests have been included in the "List of Entry Plant Quarantine Pests" in my country. Carpomyavesuviana Costa, a major quarantine pest, was discovered in Turpan in 2007, causing devastating losses to the jujube industry in the region, and the epidemic has a tendency to spread to other regions (Zhang Runzhi et al., 2007; Adili Shatar Et al., 2008). With the rapid development of China's economy, both domestic and international trade and personnel exchanges have become mor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 阿地力·沙塔尔程晓甜张伟
Owner XINJIANG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com