Product
Patsnap Eureka
For R&D, Patsnap Eureka makes reading and utilizing patents & technical documents easy.
Patsnap Eureka AIR
Designed for self-driven R&D workflows. Generate viable solutions, solve complex R&D challenges, empower your innovation with AI.
Patsnap Eureka Materials
Designed for material experts only. Revolutionize your material R&D, from search, analyze, to developing new materials.
Feature
TechResearch
Generate reliable direction feasibility study reports for your R&D in just a few steps.
TechSeek
Discover and master advanced knowledge NOW. Basics, ideas, possibilities, all at once.
TechMind
As an expert in R&D Theories, TechMind can generates customized viable solutions instantly.
TechRisk
Analyze your overall solution with one click, know your potential R&D risks in advance.
TechMonitor
Get weekly tech updates, stay abreast of the latest tech innovations and key insights.
Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
159 results about "Plant quarantine" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
Plant quarantine is a technique for ensuring disease- and pest-free plants, whereby a plant is isolated while tests are performed to detect the presence of a problem.
A gene chip, nucleotide sequence and reagent kit for detecting virus of leguminous plant
InactiveCN1952648AAchieving Simultaneous DetectionPracticalMicrobiological testing/measurementFluorescence/phosphorescencePlant virusFluorescence
A gene chip for detecting viruses of leguminous plant is disclosed, several probes and nature-control collations are fixed on surface of solidoid carrier, the probes has the nucleotide sequence showed on from SEQ ID No.1 to SEQ ID No.80; the nature-control collations consists of the surface chemistry LUT, fluorescence labeling LUT, positive LUT, negative LUT, cross LUT and blank control. The advantages and innovations of the invention are following: practicability, quick-speed, and idiocrasy, and sensitivity, low activity cost, repeatability, stable and reliable results. The testing system can guarantee the repeatability and accuracy of results that is proofed by the repeatability and stability test, the system can be widely used in area of plant quarantine of the outbound and enter the country test and quarantine system, the safety supervision of plant source food, the diagnosis of plant virus in plant protecting station and the authenticate of pathogenesis in research of plant taxonomic virology. The gene chip testing call for detecting viruses of leguminous plant can be used in about 600 daily quarantine pursuits of leguminous plant source food.
Owner:PEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU +3
Environment-friendly preventing and controlling method of diseases and pests of garden plants
InactiveCN105076087AReduce usageTo achieve the goal of green prevention and controlAnimal huntingInvasive species monitoringAgricultural scienceVermin
The invention provides an environment-friendly preventing and controlling method of diseases and pests of garden plants. The preventing and controlling method comprises the following steps: (1) quarantining plants for preventing intrusion of exotic pests; (2) physically controlling pests; (3) biologically controlling pests; (4) adopting a garden technology for controlling pests. When the preventing and controlling method is adopted to control the main pests of garden plants, the control effect reaches 92% and is increased by 35% or above compared with the conventional control effect, the use amount of a chemical pesticide is decreased by 62%, a pollution-free pesticide is adopted in parts of the green space, such as, streets where physical and biological methods are unsuitable, and the environment-friendly preventing and controlling purpose of disease and pest control of gardens and green space is achieved.
Owner:LIUZHOU RES INST OF GARDENING SCI & TECH
Comprehensive prevention and control method for anthracnose of potted sword-leaved cymbidium
The invention provides a comprehensive prevention and control method for anthracnose of potted sword-leaved cymbidium, belonging to the field of agricultural plant disease control. By aiming at the four growth stages including a leaf-bud budding stage, a bud and young leave growth stage, a flowering stage and a dormancy recovery stage of the potted sword-leaved cymbidium, five prevention and control measures including agricultural prevention and control, plant quarantine, illness monitoring, biological prevention and control, and chemical agent prevention and control are integrally assembled, so that the comprehensive prevention and control measures suitable for each growth stage are provided. The comprehensive prevention and control method for the anthracnose of the potted sword-leaved cymbidium can efficiently control the anthracnose of the cymbidium, obviously reduces number of use and usage amount of pesticide, and has great significance for improving the ornamental value and the economic value of the potted sword-leaved cymbidium and protecting the ecologic environment.
Owner:INST OF PLANT PROTECTION FAAS
Kit for detection of D. destructor in sweet potato based on loop-mediated isothermal amplification and its application
ActiveCN102260746AAvoid time lossShorten the timeMicrobiological testing/measurementDNA/RNA fragmentationAgricultural scienceDitylenchus destructor
The invention discloses a kit for detecting Ditylenchus destructor based on loop-mediated isothermal amplification and application thereof. The invention provides a special primer for assistant identification of Ditylenchus destructor and consists of DNAs shown in sequences 1-14 in a sequence table. The kit provided by the invention comprises the special primer. According to the invention, the kit for assistant identification of Ditylenchus destructor is provided through designing the specific primer and optimizing reaction conditions; and through applying the kit, an interspecies level and an infraspecies level of detection can be achieved, and the problems that the routine molecule detection method has the defects of high cost, low efficiency and slow speed and can not meet the requirements of current plant quarantine and plant protection are solved.
Owner:CHINA AGRI UNIV
Quick molecular detection method for simultaneously detecting three kinds of fusarium toxins and application thereof
InactiveCN102094080ASimple, fast and reliable identificationReduce cumbersomeMicrobiological testing/measurementDNA/RNA fragmentationBiotechnologyFood safety
The invention discloses a quick molecular detection method for simultaneously detecting three kinds of fusarium toxins and application thereof, is special for detecting three kinds of common fusarium toxins, and belongs to the technical field of plant quarantine, in particular to the technical field of molecular detection of the fusarium toxins. A plurality of composite primers are designed by the invention according to the closely related Trill gene which is synthesized by the toxins in the fusarium genome; the specific segments of the fusarium toxins nivalenol (NIV), 15 acetyldeoxynivalenol (ADON) and 3ADON are obtained from the fusarium collected in China and foreign countries through detection and separation; and the overall lengths of the specific segments of the NIV, 15ADON and 3ADON are 643bp, 424bp, and 342bp respectively. Only one group of specificity primers are used for performing polymerase chain reaction (PCR) amplification reaction, the PCR product is detected by 1.5 percent agarose gel electrophoresis, and the types of the three kinds of B type toxins produced by fusarium graminearum schw can be directly detected according to the length of the product segments; and the method can be applied to the detection of the deoxynivalenol (DON) and NIV toxin pollution in grain, feed and food safety.
Owner:INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Molecular markers for Xanthomonas oryzae and application thereof
InactiveCN103993074AQuick checkAccurate detectionMicrobiological testing/measurementMicroorganism based processesBacteroidesDisease
The invention relates to the technical fields of plant aetiology and plant quarantine and provides a batch of molecular markers capable of conveniently, rapidly and specifically identifying Xanthomonas oryzae, especially dominant molecular markers and codominant molecular markers for identification of Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola and application of the molecular markers for detection of Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola. With an identification method using each or a mixture of the molecular markers, reliability of results is better ensured, diseases can be accurately identified, which enables correct prevention and treatment measures to be taken and accords with the current development direction in inspection and quarantine, and expansion and spreading of diseases can be timely controlled.
Owner:SHANDONG AGRICULTURAL UNIVERSITY
High throughput test method for tomato bacterial disease by locking-type probe
InactiveCN103215357AShorten detection timeImprove intercept detection rateMicrobiological testing/measurementBiotechnologyDisease
The invention relates to a high throughput test method for a tomato bacterial disease, and more particularly relates to a high throughput test method which can utilize a locking probe to carry out reverse dot blot hybridization on tomato bacterial wilt original bacteria, tomato ulcer pathogenic bacteria and a tomato spot disease, and belongs to the crop preventing and curing disease and exit and entry plant quarantine range. The high throughput test method provided by the invention is based on a rolling circle amplification technology of the locking probe, a pair of universal primers are utilized for amplifying multiple pathogens, then, the high throughput test method and a reverse dot blot are combined together, a result is judged through a chromogenic reaction, the testing time of the traditional tomato bacterial disease is shortened, the specificity and the sensitivity of the detection are guaranteed, and the high throughput test is realized. According to the method, the testing cycle of the traditional pathogenic bacteria can be shortened, the cargo clearance can be increased, the intercept and capture relevance ratio of epidemic situations of imported bulk farm-product is improved, the pest invasion capacity is improved, the cargo clearance of cargoes imported and exported at ports in China is accelerated, and the enterprise cost is reduced and the high throughput test method has the important meanings.
Owner:FUQING ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
Primer and method for rapid molecular detection of eelworm
InactiveCN1482254AFast and reliable detectabilityFast and reliable identificationMicrobiological testing/measurementFermentationAgricultural scienceMeloidogyne incognita
The present invention is one kind of primer for fast molecular detection of root nematode, especially for fast molecular detection and identification of Southern, Java and peanut root nematode, and belongs to the field of crop disease and pest prevention and treatment and plant quarantine technology. Three pairs of primer, including MI-F / R, MJ-F / R and MI-F / MT-R, are designed for specifically proliferation of products with 955 bp, 517 bp and 799 bp in colony of Southern root nematode, Java root nematode and Southern, Java and peanut root nematode separately. The three pairs of primer has proliferation sensitivity of 1 / 3 two-instar larva, male adult and female adult. These primers may be used in fast detection and identification of root nematode in soil sample and root sample.
Owner:NANJING AGRICULTURAL UNIVERSITY
A gene chip, nucleotide sequence and reagent kit for detecting virus of potato family plant
InactiveCN1952649AAchieving Simultaneous DetectionPracticalMicrobiological testing/measurementFluorescence/phosphorescencePlant virusFluorescence
A gene chip for detecting viruses of nightshade is disclosed, several probes and nature-control collations are fixed on surface of solidoid carrier, the probes has the nucleotide sequence showed on from SEQ ID No.1 to SEQ ID No.70; the nature-control collations consists of the surface chemistry LUT, fluorescence labeling LUT, positive LUT, negative LUT, cross LUT and blank control. The advantages and innovations of the invention are following: practicability, quick-speed, and idiocrasy, and sensitivity, low activity cost, repeatability, stable and reliable results. The testing system can guarantee the repeatability and accuracy of results that is proofed by the repeatability and stability test, the system can be widely used in area of plant quarantine of the outbound and enter the country test and quarantine system, the safety supervision of plant source food, the diagnosis of plant virus in plant protecting station and the authenticate of pathogenesis in research of plant taxonomic virology. The gene chip testing call for detecting viruses of nightshade can be used in about 80 daily quarantine pursuits of leguminous plant source food.
Owner:PEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU +3
Integrated control method for cruciferous vegetable clubroot
InactiveCN105075738APromote germination and strong seedlingsImprove disease resistancePlant cultivationCultivating equipmentsDiseaseMedicine
The invention relates to an integrated control method for cruciferous vegetable clubroot, which comprises the following steps: 1. ecological treatment: a. applying HYT, namely applying HYT-A 200-250ml, HYT-B 250-350ml and HYT-C 100-120g every Mu, and operate the procedure 2-4 times during the whole growing period; b. applying traditional Chinese medicine microscale fertilizer one month before the cruciferous vegetable ripe, and apply the traditional Chinese medicine microscale fertilizer 20-25g every Mu; 2. agriculture control; 3. plant quarantine; 4. biological control; 5. physical control; and 6. chemical control. The method comprises the steps of ecological treatment, agriculture control, plant quarantine, physical control chemical control, therefore, the incidence of disease of the cruciferous vegetable clubroot is greatly reduced; the effect is good; and the output and the quality of the cruciferous vegetable is improved.
Owner:李美琼
Padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and multiple detection method
InactiveCN101608236ASignificant technological progressEnable multiple detectionMicrobiological testing/measurementMicroorganism based processesQuarantineErwinia
The invention provides a padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and a multiple detecting method, belonging to the fields of disease prevention and disease treatment of crops and quarantine of plants. A padlock probe sequence P-e.amy for detecting the erwinia amylovora is GACTTCGCAGGCGCCTTGCTCATTACTTPIP2ATCGGCCTGTAATCGGATCGACACGGTGTGTCGC. A padlock probe sequence P-e.pyr for detecting the Asian erwinia amylovora is TATGGCGTCCCCAAGGGGATTCGAACCCPIP2CCGACTCTAGGATCGTGGATCACTTCGTTACCGG. The method multiple detection is combined with a Macroaary technique on the basis of the probe to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora and has strong specialty, sensitivity and stability; and and a rapid, sensitive and special method is provided for detecting the erwinia amylovora and the Asian erwinia amylovora. The figure shows the result of combining the padlock probe and the macroaary technique to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora.
Owner:NANJING AGRICULTURAL UNIVERSITY
Primers and probe used for real-time fluorescent PCR assay of apricot chlorotic leafroll phtoplasma and method thereof
InactiveCN101899509AImprove the level of quarantine technologyMeet the needs of daily testing workMicrobiological testing/measurementDNA/RNA fragmentationAssayFluorescent pcr
The invention belongs to the technical field of plant quarantine, and relates to primers and a probe used for real-time fluorescent PCR assay of apricot chlorotic leafroll phtoplasma, and a detection method thereof. The primers and the probe used for real-time fluorescent PCR assay of apricot chlorotic leafroll phtoplasma are characterized by comprising a specificity Cycling probe and a pair of primers: (1) the probe (XTLJYProbe): 5'-(FAM)ATTCTGACTGTA-3'; (2) the primers: (XTLJYPrimer-F): 5'-ACTCTGACCGAGCAACGCC-3' and (XTLJYPrimer-R): 5'-GATAACGCTTGCCCCCTATG-3', wherein an RNA basic group is in the box. By comparing ITS sequences of a large amount of phtoplasma and bacteria, a set of Cycling probe and primers for real-time fluorescent PCR are designed, have the sensitivity of 0.2pg / l<-1>, and can quickly and accurately detect the apricot chlorotic leafroll phtoplasma from samples. The method has the advantages of simple operation, easy control and wide application to daily detection work in labs.
Owner:王有福 +3
Nest-type NEST-PCR amplification primer for detecting Clavibacter michiganensis subsp, michiganensis, detection kit and using method of kit thereof
InactiveCN101560570AQuick checkEasy to detectMicrobiological testing/measurementMicroorganism based processesClavibacter michiganensisA-DNA
The invention discloses a NEST-PCR amplification primer for detecting Clavibacter michiganensis subsp, michiganensis (Cmm) and a kit thereof, which belong to the categories of crop disease control and plant quarantine; and the nest-type NEST-PCR amplification primer for detecting the Clavibacter michiganensis subsp, michiganensis is characterized by a first pair of nucleotide sequences, CMM-A: gtgatgtcagagcttgctctggcggatc and CMM-a: gtacggctaccttgttacgacttagt, with the primer upstream length of 28bp and the downstream length of 26bp, and a second pair of nucleotide sequences, CMM-B: ccccgactctgggataactgcta and CMM-b; cggttaggccactggcttcgggtgttaccga, with the primer upstream length of 23bp and the downstream length of 31bp, and a DNA product with the molecular weight of 1297bp can be finally obtained by twice amplification. The kit is mainly used for amplifying the pathogens gene signals with twice PCR and has the advantages of high sensitivity, fast detection speed, accurate result and convenient use.
Owner:兰州海关技术中心
A kit for the detection of root-knot nematode Elephant ear based on loop-mediated isothermal amplification and its application
ActiveCN102268482AAvoid time lossShorten the timeMicrobiological testing/measurementDNA/RNA fragmentationLoop-mediated isothermal amplificationMeloidogynes
The invention discloses a Meloidogyne enterolobii detection kit based on loop-mediated isothermal amplification and application thereof. The invention provides special primers for assisted identification of Meloidogyne enterolobii, which are composed of DNAs (deoxyribonucleic acids) disclosed as Sequences 1 to 6 in the sequence table. The kit disclosed by the invention contains the special primers. By designing specific primers and optimizing reaction conditions, the invention provides a kit and method for qualitatively detecting Meloidogyne enterolobii 5S rDNA-IGS2 region. The invention solves the problems of high cost, low efficiency, low speed, and incapability of satisfying demands for plant quarantine and plant protection in the conventional molecular detection.
Owner:CHINA AGRI UNIV
Soybean phytophthora testing reagent kit and its test method
InactiveCN1453367AImprove accuracyGood target siteMicrobiological testing/measurementSpecific testPhytophthora sp.
The present invention belongs to the domain of crop disease prevention and treatment and plant quarantine. Based on soybean phytophthora sojae ITS gene sequence, one pair of specific oligomeric nucleotide primers are designed, and the reagent kit includes Tris. Cl 0.05 mmol, KCl 0.125 mmol, MgCl2 0.005 mmol, dNTPs 0.01 mmol, upstream and downstream primer 0.25 mmol, BSA 0.1 mg, and Taq DNA polymerase 100 U, which are mixed with pure water to prepare 1 ml of the test solution. The soybean phytophthora sojae testing reagent kit based on the primer has powerful specificity, high sensitivity and stability and may be used in fast, sensitive and specific test of soybean phytophthora sojae.
Owner:NANJING AGRICULTURAL UNIVERSITY
Molecular markers of xanthomonas oryzae pv oryzae and application thereof
InactiveCN105063036AQuick checkAccurate detectionMicrobiological testing/measurementDNA/RNA fragmentationBacteroidesPathogenic bacteria
The invention relates to the technical fields of plant aetiology and plant quarantine and provides a batch of molecular markers capable of conveniently, rapidly and specifically identifying Xanthomonas oryzae, especially dominant molecular markers and codominant molecular markers for identification of Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola and application of the molecular markers for detection of Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola. With an identification method using each or a mixture of the molecular markers, reliability of results is better ensured, diseases can be accurately identified, which enables correct prevention and treatment measures to be taken and accords with the current development direction in inspection and quarantine, and expansion and spreading of diseases can be timely controlled.
Owner:SHANDONG AGRICULTURAL UNIVERSITY
Quick Clavibacter michiganensis subsp. michiganensis IC-PCR detection kit, its preparation method and its application method
InactiveCN102465175AHigh detection sensitivityStrong specificityBacteriaMicrobiological testing/measurementForward primerPositive control
The invention relates to a quick detection kit on the level of clavibacter michiganensis subsp. michiganensis genes, which belongs to the field of plant quarantine and plant protection. The kit is suitable for the field prevention and plant quarantine of the clavibacter michiganensis subsp. michiganensis as well as the quick detection of the clavibacter michiganensis subsp. michiganensis. The quick clavibacter michiganensis subsp. michiganensis IMS-PCR detection kit is mainly characterized by comprising 500 muL of 10*PCRBuffer, 400 muL of 2.5mmol / LdNTPs, 40 muL of 5U / muL TaqDNA polymerase, 200 muL of 5mumol / L upward primer, 200 muL of 5mumol / L forward primer, a tube of deionized water, a tube of PBST, 100 tubes of PCR tube coated by Clavibacter michiganensis subsp. michiganensis specific antibody and a tube of positive control.
Owner:上海慧耘生物科技有限公司
Method for detecting and identifying Cernuella virgata Da Costa by PCR
ActiveCN103952491AReliable resultsResult Reliability GuaranteeMicrobiological testing/measurementGeneticsBioinformatics
The invention discloses a method for detecting and identifying Cernuella virgata Da Costa by PCR. The method comprises identifying molecular characteristics of the Cernuella virgata Da Costa by specific primers, wherein the upstream primer of PCR reaction is HP- (P1): 5'-GTTATTGTTACTGCTCACGC -3', the downstream primer is HP- (P2): 5'-CTGCTAAGACAGGGAGAGAT-3'. The total volume of the PCR reaction system is 25 muL, wherein the volume of 2*TaqPCRMasterMix is 12.5 muL, the volume of the upstream and downstream primers are respectively 0.5 muL, the volume of DNA template is 3 muL and the rest volume is supplied with sterile ddH2O; PCR reaction program comprises carrying out a denaturation at 94 DEG C for 5 minutes at 94 DEG C for 30 seconds, at 46 DEG C for 30 seconds, at 72 DEG C for 1 minute, circulating for 25 times, extending at 72 DEG C for 10 minutes and completing the reaction. The Cernuella virgata Da Costa can quickly and accurately detected and identified by the method disclosed by the invention. The method provides a new technical means for the detection and identification of the Cernuella virgata Da Costa in the 'List of Quarantine Pests of the People's Republic of China of the Entry of Plants' and is of great significance for preventing the Cernuella virgata Da Costa from spreading and diffusing.
Owner:INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Detection and identification kit of composite PCR of wheat stripe rust fungus and leaf rust fungus
InactiveCN101748206AEasy to operateExperiment operation is simpleMicrobiological testing/measurementBiotechnologyDisease
The invention relates to a detection and identification kit of a composite PCR of wheat stripe rust fungus and leaf rust fungus, which belongs to the technical fields of biotechnology, crop disease control and plant quarantine. The kit detects the specific genome DNA sequences of the wheat stripe rust fungus 171 bp and the leaf rust fungus 226 bp simultaneously in a primary PCR reaction by three primers from a fungal beta-tubulin gene conserved sequence and wheat stripe rust fungus and leaf rust fungus specific sequences. The invention provides supplement and improvement on the wheat stripe rust fungus and leaf rust fungus specific primer detecting method, and is suitable for the diagnostic detection of the stripe rust fungus and the leaf rust fungus in an infected wheat leaf before disease symptoms appear. Composite PCR technology is adopted in the kit, and in a PCR-SMART reaction solution, the three primers are amplified simultaneously, so the detection accuracy is increased, the detection time is saved, the operation is simple, and the kit can be applied and popularized at plant protection and plant quarantine departments in China.
Owner:HENAN AGRICULTURAL UNIVERSITY
Method for quickly identifying johnsongrass and kindred plant seeds
InactiveCN102650594AEasy identificationIdentification method is simpleColor/spectral properties measurementsPlanting seedSorghum
The invention provides a technical method for quickly and rightly identifying johnsongrass and kindred plant seeds. Seed impregnation liquid of johnsongrass and kindred plant seeds is obtained through solvent extraction and impregnation, then an ultraviolet absorbency value on a specific sensitive wave band is detected, cluster analysis charts of the johnsongrass and target species requiring identification are generated by using computer software, further the cluster analysis charts are analyzed and identified, so that the johnsongrass and the kindred plants are distinguished and the target species are identified. The method for identifying is simple, the results are reliable, the cost is low, the loss caused by error identification can be avoided, and the method is significant in plant quarantine inspection.
Owner:SHANGHAI NORMAL UNIVERSITY
A real-time classification method for plant quarantine larvae
InactiveCN103279760BDiscovered in timeReal-time recordingCharacter and pattern recognitionClassification methodsSvm classifier
Owner:杭州富光科技有限公司
Method for detecting aphelenchoides besseyi and diagnostic reagent kit
InactiveCN101812501AReliable resultsImprove reliabilityMicrobiological testing/measurementAphelenchoides besseyiDisease cause
The invention discloses a method for detecting aphelenchoides besseyi, and the method comprises the following steps: using SEQ ID NO: 1 and SEQ ID NO: 2 in a sequence table as a primer pair to carry out polymerase chain reaction; determining whether a specific fragment is obtained or not by electrophoretic analysis; and then detecting or identifying whether the specific fragment is the aphelenchoides besseyi or not. The invention also provides a reagent kit for diagnosing the aphelenchoides besseyi disease, which contains the primer pair. The method and the reagent kit have rather high reliability and sensitivity, the operation is convenient and does not rely on experience of an operator, the accuracy is high, the practicability is strong, and the method and the reagent kit can meet the needs of fast and reliable detection and identification of the aphelenchoides besseyi before agricultural crops are planted and in the plant quarantine process.
Owner:崔汝强
Complex pesticide containing carbon bisulfide fumigation pesticide as well as sterilizing and plant nematode-killing fumigation agent
The invention provides a carbon disulfide fumigation compound agent for killing insects, bacteria and nematode, which is formed by combining carbon disulfide fumigation insecticide and a fumigation medicament with the function of killing insects, bacteria and nematode. The compound agent is characterized in that the compound agent consists of the carbon disulfide fumigation insecticide, chloropicrin, o-dichlorobenzene, sulfuryl fluoride, sulfuryl chloride, chlorine gas, carbon dioxide or nitrogen as inert gas; two components are combined into the carbon disulfide fumigation compound agent for killing insects, bacteria and nematode according to weight portion; three components are combined into the carbon disulfide fumigation compound agent for killing insects, bacteria and nematode according to weight portion; four components are combined into the carbon disulfide fumigation compound agent for killing insects, bacteria and nematode according to weight portion; and five components are combined into the carbon disulfide fumigation compound agent for killing insects, bacteria and nematode according to weight portion. The combination implementing proposal of the invention performs compounding according to the fumigation and pest removal of plant quarantine, health quarantine, logs, containers, soil, commodity maintenance, scrapped vessels, animal-plane specimen museums and the like, and has great social benefit and economic benefit.
Owner:徐国淦
Integrated fluidic chip for identification of fruit fly type and use thereof
ActiveCN104894237AWide varietyMeet needsNucleotide librariesMicrobiological testing/measurementMolecular identificationDiffusion
The invention discloses an integrated fluidic chip for identification of a fruit fly type and a use thereof. The integrated microfluidic chip comprises specific primers for fruit fly type identification and a TaqMan-MGB probe. The invention provides a fruit fly type molecular identification technology utilizing the integrated fluidic chip. A test proves that the integrated microfluidic chip-based molecular identification technology realizes fast identification of a fruit fly type, has good specificity, high flux, a low cost and simple processes, realizes identification of a type of non-adult fruit fly or fruit fly adult residual body, provides a fast identification tool and technology for import and export plant quarantine and nationwide fruit fly epidemic monitoring, effectively prevents invasion and diffusion of dangerous fruit fly, protects agricultural production and ecological safety and promotes trade and economic development in China.
Owner:CHINA AGRI UNIV +1
Method for rapidly identifying opogona sacchari (entry plant quarantine pest)
InactiveCN101787394AHigh identification accuracyTest sample requirements are reducedMicrobiological testing/measurementStainingElectrophoresis
The invention discloses a method for rapidly identifying opogona sacchari (an entry plant quarantine pest), which comprises: performing PCR amplification of the extract of the genome DNA of a sample to be tested by using opogona sacchari specific primer CF720 / CR1113; performing electrophoresis on PCR amplification solution in 0.5XTE electrophoresis buffer under a voltage of 5V per centimeter of gel; and placing the PCR amplification solution in an ethidium bromide staining box for staining, and observing an amplification band with an ultraviolet gel imaging device to determine if the tested is opogona sacchari (the entry plant quarantine pest). The method has the advantages that: the identification time is reduced to less than 24 hours from the original more than one week; and the identification accuracy is improved to 99 percent from the original 70 percent. The method can help entry and exit quarantine and inspection department, customs and other related units to perform quick, accurate and high efficiency detection and identification at ports.
Owner:HUNAN AGRICULTURAL UNIV +1
Acanthoscelides obtectus standard sample and preparation method thereof
InactiveCN102323126AHigh transparencyEasy to observe fine structurePreparing sample for investigationPhaseolus acutifoliusBiochemical engineering
The invention relates to the field of plant quarantine, especially relates to an acanthoscelides obtectus standard sample, and additionally relates to a preparation method of the standard sample. In the acanthoscelides obtectus standard sample, a confirmed acanthoscelides obtectus body is embedded in a resin with one acanthoscelides obtectus per resin. The standard sample of the invention eliminates result differences caused by the using of different references in laboratories, ensures the traceability of identification results, plays an important role in the guarantee of the accuracy and reliability of acanthoscelides obtectus morphology identification results, and has important significance for gap filling in standard sample development for plant quarantine at home and abroad, and standardization of insect morphology identification work in our country.
Owner:胡强 +3
Digital animal and plant quarantine and enforcement online interaction platform based on mobile phone APP and working method thereof
InactiveCN107093064AImprove informatizationImprove the level of intelligenceOffice automationTransmissionThe InternetPaper document
The invention provides a digital animal and plant quarantine and enforcement online interaction platform based on a mobile phone APP and a working method thereof. The digital animal and plant quarantine and enforcement online interaction platform based on the mobile phone APP comprises a mobile phone client, a database server and a backstage application service platform, wherein the backstage application service platform comprises a data interaction platform and a laboratory management system; the mobile phone client builds communication connection with the data interaction platform and the laboratory management system respectively through a mobile communication network; a firewall is also arranged between the mobile communication network and the data interaction platform and the laboratory management system; and the data interaction platform and the laboratory management system are connected onto the same database server through the internet. The level of information and intelligence for port quarantine work can be improved, and the port quarantine efficiency is improved. a normative document can be checked at any time, harmful living things in need of key attention in the quarantine can be locked in advance, remote assistance is timely requested to the laboratory and a service expert through remote identification and expert cloud, and paperless sample sending is realized.
Owner:太仓海关综合技术服务中心
A method for detecting and identifying forest onion snails by fluorescent quantitative PCR
InactiveCN109182555AStrong specificityHigh sensitivityMicrobiological testing/measurementFluorescenceOrganism
The invention provides a method for detecting and identifying forest onion snails by fluorescent quantitative PCR, belonging to the molecular biological detection and identification field. The methodcomprises the following steps of: applying specific primers and probes to identify molecular characteristics of forest onion snails, wherein the upstream primers of the fluorescent quantitative PCR reaction are CNF: 5 '-CGGCCCACGCATTTGTTAT-3 ', and the downstream prim is CNR: 5'-CCACCTTCCACGAGTCTTCT-3 ', and the fluorescent probe is CNP5'- FAM-CCCACTGCTTGTGGGAGCGCC-BHQ1-3 ', 5'-labeled fluorescence reporter group is FAM, and the 3 '-labeled fluorescence quencher group is BHQ1. The method has the advantages of high detection sensitivity, short detection time, good sensitivity, strong specificity, no post-treatment of PCR, and can effectively avoid false positive and cross-contamination, and is suitable for rapid detection and identification of forest onion snails. The present invention provides a new technical method for detecting and identifying forest onion snails which are dangerous and harmful organisms and are concerned in international plant quarantine, and has important significance for preventing transmission and diffusion of forest onion snails.
Owner:INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Real-time fluorescence PCR (polymerase chain reaction) detection method based on ITS (internal transcribed spacer) gene for Opogona sacchari
InactiveCN102146477AQuick checkAccurate and stable detectionMicrobiological testing/measurementFluorescence/phosphorescenceBiotechnologyMicrobiology
The invention discloses a real-time fluorescence PCR (polymerase chain reaction) detection method based on ITS (internal transcribed spacer) gene for Opogona sacchari, comprising the following steps of: extracting the DNA of a sample to be detected, preparing the DNA into a template, performing real-time fluorescence PCR by an upstream primer, a downstream primer and a probe, and determining the variety of the sample according to the Ct value. The method is quick, stable and reliable, has high sensitivity, and is suitable for detecting different stages of Opogona sacchari. The method lays a foundation for classification on the molecular level and quick identification of allied species for Opogona (Lepidoptera: Tineidae) in China. The research results can be directly applied to quarantine and identification of Opogona sacchari in plant passed in and out quarantine, thus having great importance for protecting production safety in agriculture and forestry in China and maintaining the ecological balance.
Owner:中华人民共和国珠海出入境检验检疫局 +1
Sulfuryl fluoride compounding agent
The invention relates to a sulfuryl fluoride compounding agent for efficiently killing bacteria, insects and mice, and a preparation method thereof. The compounding agent mainly comprises the following components in part by mass: 10 to 30 parts of sulfuryl fluoride, 1 to 5 parts of dcyphenothrin, 5 to 10 parts of methyl isothiocyanate, 5 to 15 parts of dimethyl disulfide, 40 to 80 parts of carbon dioxide, and 20 to 50 parts of nitrogen. The compounding agent is prepared by sequentially loading the components into a pressure container according to the vapor pressure from low to high. The sulfuryl fluoride compounding agent can be applied to the fields of health quarantine, plant quarantine, warehousing, soil disinfection, cultural relic and the like, is low in cost, has a broad application range and low poisoning danger, and meets national environmental protection requirements.
Owner:MAUI HANGZHOU ELECTRONICS CHEM
Who we serve
- R&D Engineer
- R&D Manager
- IP Professional
Why Patsnap Eureka
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com