Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nest-type NEST-PCR amplification primer for detecting Clavibacter michiganensis subsp, michiganensis, detection kit and using method of kit thereof

A detection kit, a technology for tomato ulcers, applied in the directions of biochemical equipment and methods, microorganism-based methods, DNA/RNA fragments, etc., can solve the problems of reducing the sensitivity of PCR methods, losing pathogenic bacteria, and not greatly improving the detection cycle, etc. Achieve the effect of improving the level of quarantine and simplifying the testing procedures

Inactive Publication Date: 2009-10-21
兰州海关技术中心
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Even so, there is no significant improvement in the detection cycle, and the traditional DNA extraction process loses too many pathogenic bacteria, which inevitably reduces the sensitivity of the PCR method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nest-type NEST-PCR amplification primer for detecting Clavibacter michiganensis subsp, michiganensis, detection kit and using method of kit thereof
  • Nest-type NEST-PCR amplification primer for detecting Clavibacter michiganensis subsp, michiganensis, detection kit and using method of kit thereof
  • Nest-type NEST-PCR amplification primer for detecting Clavibacter michiganensis subsp, michiganensis, detection kit and using method of kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Embodiment 1: a kind of amplification primer of the nested Nest-PCR that detects tomato canker bacterium,

[0068] The nucleotide sequence of the first pair of primers whose upstream length is 28bp and whose downstream length is 26bp is as follows:

[0069] CMM-A: gtgatgtcagagcttgctctggcggatc;

[0070] CMM-a:gtacggctaccttgttacgacttagt;

[0071] The nucleotide sequence of the second pair of primers with an upstream length of 23 bp and a downstream length of 31 bp is as follows:

[0072] CMM-B: ccccgactctgggataactgcta;

[0073] CMM-b: cggttaggccactggcttcgggtgttaccga;

[0074] The amplification primer of the nested Nest-PCR of described detection tomato canker sore bacterium, its amplification condition is:

[0075] For the first set of primers, the amplification conditions are: increase the PCR cycle for 20 minutes, lyse the bacteria at a high temperature of 94 degrees Celsius; release DNA as an amplification template; the PCR reaction conditions are: denature at 94 d...

Embodiment 2

[0078] Embodiment 2: A nested Nest-PCR quick detection kit of tomato canker bacterium, including PCR buffer 10 *, magnesium chloride 25mmol / L; dNTP 10mmol / L, Taq enzyme 2IU / μL; Primer CMM-A and CMM -a 10 pmol / μL each, primers CMM-B and CMM-b each 10 pmol / μL, double distilled water 99% to 100%, 6 detection PCR tubes, 3 positive control PCR tubes, 3 negative control PCR tubes, positive 1 tube for control and 1 tube for negative control.

Embodiment 3

[0079] Embodiment 3: A nested Nest-PCR rapid detection kit of tomato canker bacterium, including PCR buffer 9 *, magnesium chloride 20mmol / L; dNTP 9mmol / L, Taq enzyme 2IU / μL; Primer CMM-A and CMM -a 15 pmol / μL each, primers CMM-B and CMM-b each 15 pmol / μL, double distilled water 99% to 100%, 6 detection PCR tubes, 3 positive control PCR tubes, 3 negative control PCR tubes, positive 1 tube for control and 1 tube for negative control.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a NEST-PCR amplification primer for detecting Clavibacter michiganensis subsp, michiganensis (Cmm) and a kit thereof, which belong to the categories of crop disease control and plant quarantine; and the nest-type NEST-PCR amplification primer for detecting the Clavibacter michiganensis subsp, michiganensis is characterized by a first pair of nucleotide sequences, CMM-A: gtgatgtcagagcttgctctggcggatc and CMM-a: gtacggctaccttgttacgacttagt, with the primer upstream length of 28bp and the downstream length of 26bp, and a second pair of nucleotide sequences, CMM-B: ccccgactctgggataactgcta and CMM-b; cggttaggccactggcttcgggtgttaccga, with the primer upstream length of 23bp and the downstream length of 31bp, and a DNA product with the molecular weight of 1297bp can be finally obtained by twice amplification. The kit is mainly used for amplifying the pathogens gene signals with twice PCR and has the advantages of high sensitivity, fast detection speed, accurate result and convenient use.

Description

technical field [0001] The invention relates to a gene detection amplification primer for tomato bacterial canker and a kit thereof, belonging to the field of detection of plant pathogens, and specifically for the detection of tomato bacterial canker Clavibactermichiganensis subsp, michiganensis (Cmm). It is suitable for the field prevention of tomato bacterial canker and the rapid detection of Cmm in the import and export plant quarantine. Background technique [0002] Tomato bacterial canker is one of the most important and harmful diseases of tomato. The disease can cause plant wilting, ulcers and fruit spots, seriously affecting the yield and quality of fruits. The pathogen can infect a variety of Solanaceae plants and cause a large yield reduction of vegetables, which brings huge economic losses to agricultural production. Therefore, most countries in Europe, America, and Asia currently list it as an important quarantine object. Since my country first discovered it i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/10C12R1/01
Inventor 刘箐
Owner 兰州海关技术中心
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com