223 results about "Xanthomonas oryzae" patented technology

The invention relates to a Bacillus subtilis T-500. The Bacillus subtilis T-500 has been preserved in CGMCC (China General Microbiological Culture Collection), and the preservation number is CGMCC NO:6058. The Bacillus subtilis T-500 can be used as a biological pesticide for preventing and treating multiple plant diseases, and can also be used as a biological fertilizer for promoting the yield increase of crops. The Bacillus subtilis T-500 has higher antibacterial activity on Magnaporthe oryzae, Pellicularia sasakii, Xanthomonas oryzae, Ustilaginoidea virens, Xanthomonas oryzae pv. oryzicola, Fusarium graminearum, Aspergillus flavus, Aspergillus niger and other pathogenic bacteria, and has better prevention and control effects on diseases caused by the pathogenic bacteria. The Bacillus subtilis T-500 can prevent and treat rice leaf diseases when being diluted 200-500 times on the leaves of rice, can prevent and treat bakanae diseases of rice after seed soaking, and can prevent and treat soil-borne diseases of vegetables and the like after root irrigation.

The invention discloses bacillus subtilis NB12, as well as a culture method and an application thereof. The strain with a preservation number of CGMCC No.5383 is preserved in China General Microbiological Culture Collection Center on October 24, 2011. Researches prove that: the strain has strong inhibition effects to rhizoctonia solani, colletotrichum musae, pyricularia grisea, fusarium graminearum, fusarium oxysporum f.sp.cubense, peronophythora litchi, ustilago scitaminea, fulvia fulva, xanthomonas oryzae and xanthomonas oryzae pv.oryzicola, is a broad-spectrum antagonistic strain, can be used for prevention and control of various plant diseases, has a particular good prevention and control effect to the rice sheath blight and damping off in seedling phase of cowpea, has the advantages of harmlessness to human and livestock, greenness and safety, good environment compatibility, difficult resistance generation and the like, can be used for commercial development, and has a wide application prospect.

The invention discloses a bacillus velezensis strain CSQXDZ26, which is bacillus velezensis (Bacillus velezensis) with the preservation number of CGMCC NO. 17935. The bacillus velezensis CSQXDZ26 hasremarkable antagonistic activity on bacterial plant diseases such as Xanthomonas oryzae pv. Oryzae, Xanthomonas oryzae pv. oryzicola, and xanthomonasaxonopodis pv. glycines AND THE LIKE; meanwhile, the bacillus velezensis CSQXDZ26 also has antibacterial activity on fungal plant diseases such as dithiorella gregaria, Fusarium graminearum, Fusarium oxysporum f.sp.Cucumerinum, Fusarium oxysporum f.sp. momordicae, Alternaria solani or Alternaria alternate, and also has excellent inhibition effect on common food spoilage bacteria such as bacillus subtilis, proteusbacillus vulgaris and staphylococcus aureus.

The invention relates to the technical field of plant genetic engineering, in particular relates to isolating clone and functional verification of a DAN fragment containing a gene OsWRKY45-2 related to rice disease resistance. The gene OsWRKY45-2 codes WRKY proteinoids and can endow rice with resistance to the diseases caused by bacterial pathogenic bacteria, namely the leaf blight bacteria (Xanthomonas oryzae pv.oryzae) and fungal pathogenic bacteria, namely the rice blast bacteria (Magnaporthe grisea). The fragment and the exogenous regulatory sequence thereof are directly transferred into rice, thus the resistance capability of transgenic rice with over-expression OsWRKY45-2 against bacterial blight in and rice blast is improved remarkably.

The invention disclose a pyridine salt compound containing 1,3,4-oxadiazolyl (thiadiazolyl) and a preparation method and application thereof. The compound is of the structure shown in the general formula (I). Based on the 1,3,4- oxadiazole (thiadiazole) thioether (sulfoxide or sulfone) compound, a pyridine base capable of improving the biological activity of the target compound is introduced into the system, and a series of 1,3,4- oxadiazole (thiadiazole) oxygen ether, thioether, sulfoxide or sulfone amphipathic molecules containing pyridine salt are synthesized. It is found that the compound has the good restraining effect on pathogenic bacteria and fungi such as Xanthomonas oryzae pv. oryzae, Ralstonia solanacearum, Xanthomonas axonopodis pv. citri, Gibberella zeae, Phytophythora infestans, Rhizoctonia solani, Borrytis cinerea, Fusarium oxysporum and Phytophythora infestans, and provides an important scientific foundation for new pesticide research, development and creation.

The invention relates to burkholderia cepacia, and a cultivation method and an application thereof, and belongs to the field of plant protection (microbial pesticide). A preservation number of the burkholderia cepacia is CGCC No. 5384. According to the cultivation method, fermentation conditions are as follows: an LB culture medium is used; liquid volume is 50 mL; 1 mL of 2-day old seed strain is added; and the strain is cultured for 20-24 h at a temperature of 25-30 DEG C and at a rotation speed being 200 r/min. The burkholderia cepacia has significant inhibition effects for rhizoctonia solani, pyricularia oryzae, collectotrichum musae, fusarium oxysporum f. sp. cubense, gibberella zeae, peronophythora litchi, ceratocystis adiposum, fulvia fulva, xanthomonas oryzae pv. oryzae, xanthomonas oryzae pv. oryzicola and the like, can be used for biological control of plant pathogenic bacteria, has the advantages of low toxicity, easy degradation, environment friendliness and the like, and has wide application prospects.

The invention discloses a myricetin derivative containing amide thioether thiadiazole, of which a general formula is represented as follows, wherein R is hydrocarbyl groups, phenyl groups, substituted phenyl groups, heteroaromatic ring groups or substituted heteroaromatic ring groups. The compound has high treatment and prevention effect against tobacco mosaic virus (TMV), has high anti-plant virus activity and can be used for preparing anti-plant virus pesticides. The compound has high inhibition activity on Xanthomonas axonopodis and Xanthomonas oryzae and can be used for preparing agricultural bactericides.

The invention relates to the technical field of the plant genetic engineering, in particular to the isolation and cloning and functional verification of the DNA fragment of oryza officinalis anti-Xanthomonas oryzae major gene Xa3/Xa26-2. The Xa3/Xa26-2 gene is used to code the leucine-rich protein kinase protein. The Xa3/Xa26-2 gene ensures that rice can resist diseases caused by bacterial pathogen-Xanthomonas oryzae pv. oryzae. The DNA fragment and the regulatory sequence thereof are directly transferred in rice, and the resistance capability to Xanthomonas oryzae of the transgenic rice carrying Xa3/Xa26-2 is significantly enhanced.

The invention discloses a molecular marker dCAPS (Derived Cleaved Amplified Polymorphic Sequences) for assisted breeding of an Xanthomonas oryzae resistance gene Xa7. A nucleotide sequence of the molecular marker is SEQ ID NO. 1. Primers of the molecular marker dCAPS comprise the following primer pairs, wherein the nucleotide sequence is 5'-3', a forward primer is 5'GCGGTGGTCGTGTGTTCTTCG 3', and a reverse primer is 5'TCCGGCACAGCCGCCGCCTC 3'. The invention also discloses a purpose of the molecular marker dCAPS of bacterial leaf blight resistance gene Xa7 for assisted breeding, the dCAPS molecular marker is used for assisted selection breeding of the gene Xa7or cloning the gene Xa7.

The invention relates to biocontrol Bacillus velezensis SF259 and application thereof. The Bacillus velezensis strain is collected in the China Center for Type Culture Collection (CCTCC) on September20, 2019, with the collection name of Bacillus velezensis SF259 and the collection number of CCTCCM 2019735. The Bacillus velezensis has a significant inhibition effect on xanthomonas oryzae pv. oryzae (Xoo), also shows broad-spectrum bacteriostatic activity for xanthomonas oryzae pv. oryzicola (Xoc), X. campestris pv. musacearum, X. axonopodis pv. vignicola, X. campestris pv. malvacearum, botrytis cinerea and magnaporthe oryzae, and has important biocontrol application prospects.

The invention relates to the technical field of plant gene engineering, in particular to the isolation cloning and function verification of a DNA fragment containing a rice disease resistance related gene OsWRKY45-1. A nucleotide sequence of the OsWRKY45-1 gene and an amino acid sequence encoded by the gene are shown in SEQ ID NO: 1. Genetically transformed rice of which the expression level of the OsWRKY45-1 gene is remarkably reduced apparently strengthens the resistance on xanthomonas oryzae pv. oryzae and xanthomonas oryzae pv.oryzicola, which proves that the OsWRKY45-1 gene is a negative regulatory factor in reactions of resisting bacterial blight and bacterial stripe of rice, and the disease resistance of the rice can be improved by inhibiting the expression of the OsWRKY45-1 gene.

The invention provides a bactericidal composition containing tetramycin and zhongshengmycin. The bactericidal composition comprises compounded effective components consisting of tetramycin and zhongshengmycin, with the balance being auxiliary components. The mass ratio of tetramycin to zhongshengmycin in the composition is 1-50 50-1, and the mass fraction of tetramycin and zhongshengmycin in a preparation is 1 to 80%, with the balance being auxiliary components which are allowed to use and admitted in pesticides; dosage forms of the composition comprise missible oil, a suspending agent, a wettable powder, a water dispersible granule, an emulsion in water, a micro-emulsion, a granule and a micro capsule. The composition is mainly used for preventing and treating rot diseases of fruit trees, alternaria leaf spot, rice blast, soybean root rot, fusarium wilt of cucurbits, cotton verticillium wilt, rust diseases of jujube trees, white rot of grape, black spot of ginseng and pseudo-ginseng, Exobasidium vexans Massee of tea, forest rot, canker, gumming diseases, leaf cast, damping off of forest seedlings, soft rot bacteria of vegetable, Pseudomonas lachrymans, Xanthomonas oryzae pv. oryzae, Physalospora piricola, Fusarium graminearum, etc.

A disclosed biological bactericide for controlling paddy rice diseases employs cinnamon essential oil as the active component. Specifically, the biological bactericide is composed of cinnamon essential oil, a surfactant, a co-emulsifier and water, and per Kg of the biological bactericide contains 0.75-75000 mg of cinnamon essential oil, 1.75-175000 mg of the surfactant, 0.75-75000 mg of the co-emulsifier and the balance water. The biological bactericide is mainly used for controlling xanthomonas oryzae pv.oryzae.

The invention relates to bacillus subtilis. The preservation number of the strain is CGMCC NO: 9269. The strain is obtained by deep fermentation, ceramic membrane concentration and spray-drying. A shaking culture liquid of the strain has an obvious effect of inhibiting the target germ Xanthomonas oryzae pv. oryzae, the target germ ralstonia solannacearum, the target germ Pseudomonas syringae pv. tabaci, the target germ Xanthomonas axonopodis pv. citri and the target germ cercosporella albomaculans. The bacillus subtilis provided by the invention has advantages of fast growth and propagation, short fermentation period, high filling spore number, good control efficiency and the like. Meanwhile, a preparation method of the strain has simple steps, is convenient to operate, comprises steps of deep fermentation, ceramic membrane concentration and spray-drying to obtain the bacillus subtilis, has high preparation efficiency and has good effects. The strain can control various bacterial diseases and now has been registered on cercosporella albomaculans, Xanthomonas axonopodis pv. citri, Pseudomonas syringae pv. tabaci, ralstonia solannacearum and Xanthomonas oryzae pv. oryzae.

The invention relates to a bio-control bacillus velezensis, a separation method and an application thereof. The bacillus velezensis has been preserved in China Center for Type Culture Collection on July 25, 2018; the preserving name is bacillus 504 or bacillus velezensis 504; the preserving number is CCTCC NO: M2018493. The bacillus velezensis provided by the invention has an obvious inhibiting effect to xanthomonas oryzae pv, has broad-spectrum bacteriostatic activity to xanthomonas oryzae pv. oryzicola, banana bacterial wilt, campestris pv.vesicatoria, walnut bacterial black spot, cowpea fusarium wilt, and the like, and has a significant bio-control application prospect.

The invention relates to the technical field of plant gene engineering, more particularly to isolation and cloning as well as functional verification of DNA fragment containing Oryza minuta bacterial blight-resisting major gene Xa3/Xa26-3. Xa3/Xa26-3 codes leucine-rich protein kinase-type protein, which can enable paddy rice to resist the diseases caused by bacillary pathogenic bacteria-bacterial blight bacteria(Xanthomonas oryzae pv. Oryzae). The fragment and self-regulatory sequences thereof are directly transplanted into paddy rice, therefore, Xa3/Xa26-3. Xa3/Xa26-3-carrying transgenic rice is prominently strengthened in resisting bacterial blight.

The invention relates to a preparation method for a carbazolylv isopropanolamine derivative with the chiral center and application. The structure of the compound is shown in the formula (I), and the compound achieves the better effect of inhibiting xanthomonas oryzae, ralstonia solanacearum, cucumber xanthomonas oryzae, konjak xanthomonas oryzae, xanthomonas citri, grape ulcer bacteria, tomato ulcer bacteria, kiwi fruit ulcer bacteria, apple ulcer bacteria, cucumber botrytis cinerea, chili blight bacteria, sclerotinia sclerotiorum, wheat gibberella saubinetii, potato late blight, blueberry root rotting bacteria and the like.

The invention relates to Bacillus velezensis 229-15 and application thereof. The Bacillus velezensis is preserved in the Chinese Type Culture Collection on September 20, 2019, the sample name is Bacillus 229-15 Bacillus sp. 229-15, the preservation number is CCTCC No: CCTCC M 2019734, and the strain is isolated from a campus soil sample in Gansu Agricultural University, Anning District, Gansu Province in China. The Bacillus velezensis 229-15 has a bacteriostatic effect on Xanthomonas oryzae pv.oryzae, Xoo and Xanthomonas oryzae pv.oryzicola, Xoc, and also has bacteriostatic effects on X.campestris pv.musacearum, X.axonopodis pv.vignicola, X.campestris pv.phaseoli and Magnaporthe oryzae, Botrytis cinerea, Fusarium graminearum and other pathogenic fungi at the same time. It is shown throughresults that the strain has a broad-spectrum bacteriostatic ability, good biocontrol resources are provided for prevention and control of Xanthomonas oryzae pv.oryzae, Xoo and Xanthomonas oryzae pv.oryzicola, Xoc, and a foundation is laid for development of novel microbial agents.

The invention discloses an application of a bacterial blight resistance related gene OsPRX30, belonging to the technical field of plant genetic engineering. The expression of OsPRX30 gene is increasedafter induction by Xanthomonas oryzae pv. Oryzae pv. Oryzae. The gene is up-regulated after induction by Xanthomonas oryzae pv. Oryzae and the resistance to Xanthomonas oryzae pv. Oryzae could be enhanced by knockout. OsPRX30 edit site sequence is ligated with U3 promoter and cloned into gene editing vector pYLCRISPR/Cas9Pubi-H, and that gene can negatively regulate the resistance of rice to bacterial blight. The gene editing vector constructed by the invention can be used in rice breeding for resistance to bacterial blight. The present invention is helpful to better understand the mechanismof action of OsPRX30, and the cloning of OsPRX30 is helpful to further understand rice. Bacterial blight pathogen interaction, disease resistance signal transduction pathway laid the foundation, has great application value in breeding.

The invention discloses a method for detecting Xanthomonas oryzae pv.oryzae, Xoo, X.oryzae pv. Oryzicola, Xoox, X.axonopodis pv. Citri, Xac, and X.campestris pv.campestris, Xcc. The method comprises the following steps: carrying out PCR (polymerase chain reaction) amplification on the DNA template of a sample to be detected by using two pairs of primers at the same time; then, hybridizing the PCR products with the specific probe arranged on a gene chip; and judging whether the sample to be detected is with Xanthomonas oryzae pv.oryzae, Xoo, X.oryzae pv. Oryzicola, Xoox, X.axonopodis pv. Citri, Xac, and X.campestris pv.campestris, Xcc according to the fact whether the hybridization result is positive or not. Therefore, the method of the invention is capable of detecting four bacteria by one time with high detection speed and has the advantages of direct-viewing and clear detection result and easy judgment.

The invention discloses a myricetin derivative containing amide-oxadiazole and a preparation method and application of the myricetin derivative. General formula (A) is as shown in specification, wherein R is alkyl consisting of 1-6 carbon atoms, alkoxy consisting of 1-6 carbon atoms, halogen atoms and nitryl. According to substituted phenyl, one or two alkyls consisting of 1-6 carbon atoms, alkoxyconsisting of 1-6 carbon atoms, halogen and nitryl are arranged at an ortho-position, a meta-position and a para-position of a benzene ring. The myricetin derivative resists tobacco mosaic viruses, xanthomonas citri and xanthomonas oryzae pv. oryzae.

The invention relates to the technical field of plant gene engineering, in particular to separation, cloning and function verification of a DNA fragment containing rice disease resistance related genes GH3-2. The genes GH3-2 code auxin amide synthetase. The genes GH3-2 can endow the rice with function of resisting the diseases caused by bacterial pathogenic bacteria Xanthomonas oryzae pv. oryzae, bacterial Xanthomonasoryzae pv. oryzicola and fungal pathogenic bacteria Magnaporthe grisea. The fragment and the exogenous adjusting sequence thereof are directly transferred into the rice, and the transgenic rice for excessively expressing the GH3-2 has the remarkably enhanced resistance to the Xanthomonas oryzae pv. oryzae, bacterial Xanthomonasoryzae pv. oryzicola and the Magnaporthe grisea.