Padlock probe for detecting Xanthomonas oryzae pv. oryzae and anthomonas oryzae pv.oryzicola and multiple detection method

A technology for rice bacterial blight and p-x.o.oc, which is applied in the biological field, can solve problems such as difficulty in realizing multiple detection, and achieve the effects of avoiding false positives, strong specificity and high sensitivity

Inactive Publication Date: 2009-12-23
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0024] The purpose of the present invention is to solve the problems in the prior art that the molecular detection methods for rice bacterial blight and rice bacterial streak are difficult to realize multiple detection, and provide methods for detecting rice bacterial blight and rice bacterial streak respectively. The padlock probe of the pathogen and the molecular detection method for the simultaneous detection of these two pathogens can detect bacterial blight of rice and bacterial spot of rice with high sensitivity and strong specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Padlock probe for detecting Xanthomonas oryzae pv. oryzae and anthomonas oryzae pv.oryzicola and multiple detection method
  • Padlock probe for detecting Xanthomonas oryzae pv. oryzae and anthomonas oryzae pv.oryzicola and multiple detection method
  • Padlock probe for detecting Xanthomonas oryzae pv. oryzae and anthomonas oryzae pv.oryzicola and multiple detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: A multiple detection method using padlock probes combined with Macroaary technology for simultaneous detection of Xanthomonas oryzae and bacterial streak.

[0051] The padlock probe sequence used to detect Xanthomonas oryzae:

[0052] P-x.o.o: 5'-GGAGCTATATGCCGTGCTGTGTGGAGTAP I P 2 * GAATCGCCTACAATTCTGTC CCCCAAGTTGCCTC-3' is used to detect the padlock probe sequence of rice bacterial leaf spot:

[0053] P-x.o.oc: 5'-CCACACAACACGGCATATCGCTCCAAGGP I P 2 * GCGGCATACGTTCGTCAAAT GGTGGCTTTGTACC-3'

[0054] (1) Ligation reaction solution includes: 20mM Tris-HCL, pH 9.0, 25mM KCH 3 COO, 10mM Mg (CH 3 COO) 2 , 10mM DTT, 1mM NAD, 0.1% Triton X-100, 2.4U Taq DNA ligase, 1μl template to be tested, probe P-x.o.oc, P-x.o.oc each 100pm. The ligation reaction program is: pre-denaturation at 95°C for 5 minutes; then cycle, denaturation at 95°C for 30 seconds, ligation at 65°C for 5 minutes, and a total of 20 cycles of reaction; then inactivation at 95°C for 15 m...

example 1

[0057] Example 1 detects Xanthomonas oryzae and bacterial streak bacterium from the rice of Anhui morbidity:

[0058] The above-mentioned padlock detection probes of rice bacterial blight and bacterial streak and their multiple detection methods are used to detect the diseased rice in Anhui, and the methods include:

[0059] 1) Extract DNA from the roots (R), stems (S) and leaves (L) of rice samples infected in Anhui as detection templates, and the extraction method refers to Mc McCouch S R (1988).

[0060] 2) Referring to the above technical scheme, use padlock detection probes P-xoo and P-xooc combined with Macroaary to detect samples. See the test results Figure 5 . The results showed that 19 of the 60 rice samples with the disease in Anhui were detected to have bacterial blight, and 17 to have bacterial streak. It is proved that the above-mentioned technical scheme can be applied to the actual detection of rice bacterial blight and bacterial streak.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a padlock probe for detecting Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv.oryzicola and a multiple detection method, belonging to the fields of disease prevention and treatment of crops and quarantine of plants. A padlock probe sequence P-x.o.o for detecting the Xanthomonas oryzae pv. oryzae is GGAGCTATATGCCGTGCTGTGTGGAGTACTCGACCGTTAGCAGCATGACCGAGATGTACCGCTATCGTGAATCGCCTACAATTCTGTCCCCCAAGTTGCCTC. A padlock probe sequence P-x.o.oc for detecting the Xanthomonas oryzae pv.oryzicola is CCACACAACACGGCATATCGCTCCAAGGCTCGACCGTTAGCAGCATGACCGAGATGTACCGCTATCGTGCGGCATACGTTCGTCAAATGGTGGCTTTGTACC. The multiple detection method is combined with a Macroaary technique on the basis of the probe to simultaneously detect the Xanthomonas oryzae pv. oryzae and the Xanthomonas oryzae pv.oryzicola and has strong specialty, sensitivity and stability; and a rapid, sensitive and special method is provided for detecting the Xanthomonas oryzae pv. oryzae and the Xanthomonas oryzae pv.oryzicola. The figure shows the result of combining the padlock probe and the Macroaary technique to simultaneously detect the Xanthomonas oryzae pv. oryzae and the Xanthomonas oryzae pv.oryzicola.

Description

(1) Technical field [0001] The invention relates to a padlock probe for detecting rice bacterial blight (Xanthomonas.oryzae pv.oryzae) and rice bacterial streak (Xanthomonas.oryzae pv.oryzicole) and a multiple detection method capable of simultaneously detecting these two plant pathogens, Belongs to the field of biotechnology. Suitable for port inspection and quarantine, agricultural production, plant protection and other departments. (2) Background technology [0002] Rice bacterial blight is a worldwide disease, and the annual loss of rice production ranges from 10% to 30% or even more than 50%. Since it occurred in Japan in 1884, it has been found in Asia, Europe, Oceania, Africa and North America (Mew T.1989), and its occurrence range has spread all over the world's rice cultivation areas (Ou SH.1985; Mew TW 1987; Swing J M. 1990). Rice bacterial streak is also an important bacterial disease that harms rice. Its damage is second only to rice bacterial blight, and it i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11C12R1/64
Inventor 胡白石田艳丽刘凤权王源超郑小波
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products