34results about How to "Result Reliability Guarantee" patented technology

The invention discloses a method for identifying helix pomatia by PCR (polymerase chain reaction) detection, which uses specific primers to identify molecular characteristics of helix pomatia. The forward primer for the PCR reaction is HP-(P1): 5'-TTCGTTGAGAGTTAGG-3', and the reverse primer is HP-(P2): 5'-ATAGTAATAGCACCAGC-3'. The total volume of the PCR reaction system is 25 mu L, wherein the 2*TaqPCRMasterMix is 12.5 mu L, the forward and reverse primers are respectively 0.5 mu L, the DNA (deoxyribonucleic acid) template is 2 mu L, and the rest is sterilized ddH2O. The PCR reaction process comprises the following steps: pre-denaturating at 5 DEG C for 5 minutes; treating at 95 DEG C for 30 seconds, 45 DEG C for 30 seconds and 72 DEG C for 1 minute, and repeating 30 times; and extending at 72 DEG C for 10 minutes, and finishing the reaction. The method disclosed by the invention can quickly and accurately detect and identify helix pomatia. The invention provides a new technical means for detection and identification of helix pomatia in the Catalogue of Quarantine Pest for Import Plants to the People's Republic of China, and has important meanings for preventing helix pomatia from spreading and diffusion.

The invention discloses a Phytophthora capsici LAMP primer and a rapid detection method thereof, which are specially used for the specific detection of Phytophthora capsici. Mainly designed a LAMP primer (F3, B3, FIP, BIP) of Phytophthora capsici, using this primer for constant temperature amplification and adding 50μM Calcein-500μM MnCl2 color reagent or agarose gel electrophoresis detection, it can be observed to green fluorescence or a trapezoidal band characteristic of LAMP. The present invention can be used for rapid, sensitive and accurate detection of Phytophthora capsici in plants and soil infected by Phytophthora capsici in production practice, and can be used for early diagnosis of field diseases and monitoring and identification of pathogens. Provide reliable technical and theoretical basis for disease control.

The present invention provides a kind of LAMP detection primer of sweet potato Pyrogenic diosminum and its visual detection method, mainly designs a group of LAMP primers F3, B3, FIP, BIP of sweet potato Pyrogenic diosminum; Utilizes LAMP to amplify at constant temperature, after the amplification reaction, pass Chromogenic reaction or agarose gel electrophoresis detection, the fluorescent green or the characteristics of the trapezoidal band during electrophoresis can be directly observed with the naked eye. The loop-mediated isothermal amplification technology established by the present invention for Pyrophthora japonica in sweet potato can realize the rapid detection of Pyrophila potato in diseased tissues (plants, potato pieces), and has the advantages of rapid amplification, high efficiency, good specificity, and easy operation , No need for special equipment and other advantages, providing a reliable technical basis for the control of sweet potato blast fungus.

The invention discloses a method for detecting and identifying the Mediterranean white snail by PCR. The method uses specific primers to identify the molecular characteristics of the Mediterranean white snail; the upstream primer of the PCR reaction is HP-(P1):5'-? GTTATTGTTACTGCTCACGC? -3', the downstream primer is HP-(P2): 5'-? CTGCTAAGACAGGGAGAGAT? -3'. The total volume of the PCR reaction system is 25 μL, in which 2×Taq? PCR? MasterMix? 12.5 μL, 0.5 μL of upstream and downstream primers, 3 μL of DNA template, and the rest was supplemented with sterilized ddH2O; the PCR reaction program was: 94 °C pre-denaturation for 5 min; 30s, 46°C? 30s, 72°C? 1 min, 25 cycles; 72 ° C extension for 10 min, the end of the reaction. The method of the invention can quickly and accurately detect and identify the Mediterranean white snail. The invention provides a new technical means for the detection and identification of the Mediterranean white snail in the List of Imported Plant Quarantine Pests of the People's Republic of China, and is of great significance for preventing the spread and spread of the Mediterranean white snail.

The invention discloses a peronophythora litchii LAMP (loop-mediated isothermal amplification) primer and a rapid detection method thereof which are specially applied to specific detection of peronophythora litchii. The peronophythora litchii LAMP primer is mainly adopted and designed, and through isothermal amplification visual inspection or agarose gel electrophoresis detection, green fluorescence can be observed or an LAMP characteristic ladder can appear. The LAMP primer and a usage method thereof can be applied to rapid, sensitive and accurate detection of the peronophythora litchii in plants infected with the peronophythora litchii in production practice, can also be applied to early diagnosis of diseases and pests in fields as well as monitoring and identification of germs, and provide reliable technical and theoretical bases for control of diseases and pests caused by the peronophythora litchii.

The invention discloses cucumber phytophthora LAMP (Loop-mediated Isothermal Amplification) primer and a rapid detection method thereof, which are specifically used for the specific detection of cucumber phytophthora. The rapid detection method is characterized in that a cucumber phytophthora LAMP primer is mainly adopted and designed, detailed information can be seen in SEQ NO.1-SEQ NO.4. Green fluorescent light or an LAMP characterized ladder-shaped pattern can be observed through the LAMP and the color developing by adding an SYBR green I color agent for developing color or the agarose gel electrophoresis detection. The LAMP primer and the rapid detection method, which are disclosed by the invention, can be used for quickly, sensitively and accurately detecting the cucumber phytophthora in plants and soil which are affected by the cucumber phytophthora in production practice and can be simultaneously used for the early diagnosis of diseases in filed and the monitoring and the identification of germs, and reliable technical and theoretical basis is provided for preventing the disease caused by the cucumber phytophthora.

The invention discloses an LAMP (Loop-Mediated Isothermal Amplification) primer of phytophthora nicotianae and a fast detection method thereof, which are especially used for specific detection of the phytophthora nicotianae. The LAMP primer adopted and designed is F3, B3, FIP and BIP, and the sequence of the LAMP primer is shown in SEQIDNO.1-4. Green fluorescence can be observed or the ladder pattern of LAMP characteristic occurs by isothermal amplification and addition of SYBRgreenI color-developing agent for color development or sepharose for gel-electrophoresis detection. The LAMP primer and the use method can be used for fast, sensitive and accurate detection of the phytophthora nicotianae in plants and soil infected by the phytophthora nicotianae in production practice, simultaneously can be used for early diagnosis of diseases in the field and monitoring and identification of germs, and provide reliable technical and theoretical basis for controlling the diseases caused by the phytophthora nicotianae.

The invention discloses an aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and a visualized detection method of the aspergillus flavus LAMP detection primer, which are specially used for specific detection of aspergillus flavus. The invention mainly designs one aspergillus flavus LAMP detection primer (comprising a pair of outer side primers and one pair of inner side primers); green fluorescence or a trapezoidal zone with an LAMP characteristic can be observed by carrying out isothermal amplification and adding a 50micronM Calcein-500micronM MnCl2 developing agent to develop or carrying out agarose gel electrophoresis detection. The aspergillus flavus LAMP detection primer and the visualized detection method of the aspergillus flavus LAMP detection primer can be used for visualized detection of aspergillus flavus in crops including peanuts, corns and the like which are infected by the aspergillus flavus in production practices, and can also be used for early diagnosis, monitoring and identification of bacteria in tissues of the peanuts or the corns which are naturally attacked.