60 results about "5-Methylcytosine" patented technology

Nucleic acids comprising β-glucosaminyloxy-5-methylcytosine; compositions, kits and methods of producing the nucleic acids using a glycosyltransferase; and methods of using the nucleic acids are described.

The present invention concerns a method for the detection of cytosine methylation in DNA samples, wherein the following steps are conducted: (a) a genomic DNA sample, which comprises the DNA to be investigated and background DNA, is chemically treated in such a way that all of the unmethylated cytosine bases are converted to uracil, whereas the 5-methylcytosine bases remain unchanged; (b) the chemically treated DNA sample is amplified with the use of at least 1 primer oligonucleotide as well as a polymerase, whereby the DNA to be investigated is preferred as the template over the background DNA, and (c) the amplified products are analyzed and the methylation status in the DNA to be investigated is concluded from the presence of an amplified product and/or from the analysis of additional positions.

Particular aspects of the present invention provide a method for quantification of two different variations of a DNA sequence. Particularly, the invention relates to a quantification of methylated DNA, and for this purpose, the test DNA is converted so that cytosine is converted to uracil, while 5-methylcytosine remains unchanged. The converted DNA is amplified by means of a real-time PCR, wherein two labeled real-time probe types are utilized: one specific for methylated DNA; and one for unmethylated DNA. Preferably, the degree of methylation of the test DNA is calculated from the ratio of the signal intensities of the probes or from the Ct values. The inventive methods have substantial utility for diagnosis and prognosis of cancer and other disorders associated with altered or characteristic DNA methylation status, as well as having substantial utility for analysis of SNPs, allelic expression, and prediction of drug response, drug interactions, among other uses.

The invention relates to a library construction method, a sequencing method and a methylation detection method for sequencing 5-methylcytosine (5mC) modified bisulfite on RNA molecule. By designing and using triplet base random hexamers which contain ACT only, RNA fragment reverse transcription, PCR amplification efficiency and 5mC site detection efficiency after bisulfite treatment can be significantly improved, which is conducive to high-throughput sequencing of the 5mC site.

The invention discloses a method for high performance liquid chromatography (HPLC)-mass spectrometry (MS) detection of DNA oxidation and DNA methylation, and the method comprises the following steps: hydrolyzing DNA, measuring the content of 5-methyl cytosine (5-mdC) and 8-hydroxy deoxyguanosine (8-OHdG) in the DNA hydrolysis product by HPLC-ESI (electrospray ionization)-MS / MS; wherein the high performance liquid chromatography is performed as follows: a mobile phase A is formic acid / methanol with the volume ratio of 0.01-0.3, a mobile phase B is a formic acid water solution with the volume ratio of 0.01 to 0.3%, and under the conditions of the flow velocity of 0.2-0.4ml / min and the column temperature of 15 to 40 DEG C, separation is performed by a liquid chromatography column; ESI (electrospray ionization)-MS is performed as follows: an electrospray ion source is ionized, and mass spectrometric analysis is performed in the positive electrode mode by a multiple reaction monitoring system. The method for high performance liquid chromatography (HPLC)-mass spectrometry (MS) detection of DNA oxidation and DNA methylation can simultaneously detect the content of 8-OHdG and 5-mdC in a DNA sample.

A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.

The invention provides a method for testing non-ethylating CpG content, which comprises adopting specific methylaseSssI to modify CpG dinucleotide aracytidine into 5-methylcytosine, then using nucleicacidase P1 and bacterial alkaline phosphatase to hydrolyze DNA into single deoxynucleoside, using a reversed-phase hplc method to test quantity of the 5-methylcytosinein DNA hydrolytic samples which are both modifying and un-modifying, and testing the CpG through differences of the 5-methylcytosine detectable amount between the modifying DNA hydrolytic sample and the un-modifying DNA hydrolytic samples.

The invention relates to a method for detecting 5-methylcystein in DNA. The method is used for detecting the 5-methylcystein in the DNA based on an asymmetric PCR (polymerase chain reaction) theory by applying dGTP (deoxyguanosine triphosphate) containing a fluorophore. The method comprises the specific detection steps of treating the DNA containing the 5-methylcystein by a sodium hydrogen sulfite method, converting cytosine in the DNA into uracil, and obtaining complementary chains of a large amount of target DNAs through asymmetric PCR, wherein adenine without fluorescence is complementary to the cytosine in the DNA, and dGTP with fluorescence is compensatory to the 5-methylcystein; detecting 5-methylcystein in the DNA through DNA gel electrophoresis (PAGE). Therefore, the 5-methylcystein in the DNA can be subjected to fluorescence detection through excitation at 492 nanometers.

The invention relates to nucleoside derivatives with photolabile protecting groups of general formula (I), where R1=H, F, Cl, Br, I, NO2; R2=H, CN, where R1 and R2 are not simultaneously H; R3=H, 1-4 C alkyl, phenyl; R4=H or a conventional functional group for the synthesis of oligonucleotides; R5=H, OH, halogen or XR6, where X=O or S and R6=a conventional nucleotide protecting group; B=adenine, cytosine, guanine, thymine, uracil, 2,6-diaminopurin-9-yl, hypoxanthin-9-yl, 5-methylcytosin-1-yl, 5-amino-4-imidazolcarboxamid-1-yl or 5-amino-4-imidazolcarboxamid-3-yl, where, if B=adenine, cytosine or guanine the primary amine functionality, optionally, carries a permanent protecting group. Furthermore, these derivatives may be used for the light-controlled synthesis of oligonucleotides on a DNA chip.

Described is a method for detecting 5-methylcytosine in genomic DNA samples. First, a genomic DNA from a DNA sample is chemically converted with a reagent, 5-methylcytosine and cytosine reacting differently, and the pretreated DNA is subsequently amplified using a polymerase and at least one primer. In the next step, the amplified genomic DNA is hybridized to at least two oligonucleotides, the latter being joined by inserting at least one oligonucleotide. In the ligation product, one nucleotide carries a detectable label, and the elongation depends on the methylation status of the specific cytosine in the genomic DNA sample. In the next step, the elongated oligonucleotides are analyzed for the presence of the label.

The invention relates to a method for quantitatively detecting the deoxyribonucleic acid (DNA) demethylation capability of pollutant, and belongs to the field of the methods for detecting the health damaging capability of the pollutant. At present, no mature detection technology is provided for evaluating the DNA demethylation capability of the pollutant. The method comprises the following steps of: manually methylating fluorescent plasmids; transferring Hela cells from highly-methylated fluorescent plasmids to prepare reconstitution cell strains; performing pretreatment on a pollutant sample; co-culturing 5-methylcystein standard series and the reconstitution cell strains and synchronously co-culturing the tested sample and the reconstitution cell strains; performing fluorescent photographing and fluorescence intensity treatment on the reconstitution cell strains; drawing a pollutant demethylation capability detection standard curve; and quantitatively detecting the demethylation capability of the tested sample pollutant. If green fluorescent light emitted from tested cells is brighter, the demethylation capability of the pollutant is higher and the risk of health damage to a human body is higher. A rapid, simple and quantitative detection method is provided for evaluating the human DNA demethylation capability of the pollutant.

The invention discloses a method for measuring DNA methylation content of floating fern by using high performance liquid chromatography. The method comprises the following steps: collecting a floating fern sample to be measured and extracting DNA in the sample to obtain a DNA sample to be measured; storing the DNA sample at the temperature of -20 DEG C for later use after the DNA sample is dissolved in buffer liquid; hydrolyzing the DNA sample to be measured and centrifuging the hydrolyzed DNA sample; taking supernatant liquid so as to obtain the solution of the sample to be measured; preparing the mixed solution of standard samples of a cytosine standard sample and a 5-methylcytosine standard sample; and measuring the DNA methylation content of the DNA sample to be measured according to peak retention time and peak areas of the mixed solution of the standard samples and the solution of the sample to be measured under the same high performance liquid chromatography measurement condition. In the method, the DNA methylation content of the floating fern is measured by using the high performance liquid chromatography; and therefore, the method has the characteristics of simplicity, low cost, fast and accurate measurement, and good quantitative analysis effect. Simultaneously the high performance liquid chromatographic technology per se is used very widely, the technology is mature relatively, and the DNA extraction from the floating fern can be implemented by using a conventional method, so the method can be popularized and applied.

The invention relates to a chemical method for detecting 5-methylcystein in DNA (Deoxyribose Nucleic Acid). Two compounds adopted in the method are substituted chloramine-B hydrate and substituted bromoamine-B hydrate. The method comprises the detection steps of allowing the substituted chloramine-B hydrate to react with cytosine in the fluorescently-labeled DNA, then allowing the substituted bromoamine-B hydrate to react with the cytosine and the 5-methylcystein in the fluorescently-labeled DNA, treating with piperidine, and comparing two reacted DNA zones in DNA polyacrylamide denatured gel to clearly observe the positions and the number of the 5-methylcystein.