77 results about "Clusterin" patented technology

Agents that perturb the EGF signaling pathway and that are known to be useful in the treatment of cancer are found also to result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. This is overcome using a combination of an agent that has known therapeutic efficacy against the cancer to be treated by perturbation of the EGF signaling pathway and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells small molecule inhibitor of HER-2, an antisense oligonucleotide specific for HER-2, or a peptide agent capable of interfering with HER-2 protein. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide.

The invention relates to the use of clusterin, or of an agonist of clusterin activity, for treatment or prevention of peripheral neurological diseases, The invention further relates to the use of a combination of clusterin and heparin, for treatment or prevention of peripheral neurological diseases.

Methods and compositions are disclosed for inhibiting, deterring or preventing apoptosis of cardiac myocytes, transplanted stem cells, vascular stem cells, and vascular smooth muscle cells by means of expressing or synthesizing clusterin. Also disclosed are methods and compositions for producing recombinant clusterin, or its biologically active peptides, and for induction of clusterin-associated lipoproteins or enzymes for deterring or preventing inflammatory injury and apoptosis induced by oxLDL, oxysterols, cytokines, and Fas Ligand. Also disclosed is an induction method and composition for enhancing expression of ALDH and ALDH-associated enzymes or co-factors to prevent cytotoxicity or detoxification. Therapeutic methods providing new expression or overexpression of clusterin in vascular or cardiac tissue are expected to inhibit the formation of atherosclerotic lesions, stabilize existing atherosclerotic plaques, and repair failing or damaged cardiac tissue.

The invention relates to a method of diagnosis of Huntington's Disease in a diagnostic sample of a valid body tissue taken from a human subject, which comprises detecting an altered concentration of a protein in the diagnostic sample, compared with a sample of a control human subject, the protein being selected from: Swiss Prot accession number: Protein name; P10909: Clusterin precursor; P00738: Haptoglobin precursor; P01009: Alpha-1-antitrypsin precursor; P01024: Complement C3 precursor; P01620: 1 g kappa chain V-III region; P01834: 1 g kappa chain C region P01842: 1 g lambda chain C regions; P01857: 1 g gamma-1 chain C region; P01859: Ig gamma-2 chain C region; P01876: 1 g alpha-1 chain C region P02647: Apolipoprotein A-I precursor; P02649: Apolipoprotein E precursor; P02652: Apolipoprotein A-II precursor; P02655: Apolipoprotein C-II precursor; P02656: Apolipoprotein C-II precursor P02671: Fibrinogen alpha/alpha-E chain precursor; P02763: Alpha-1-acid glycoprotein 1 precursor; P02766: Transthyretin precursor; P02768: Serum albumin precursor; P02787: Serotransferrin precursor; P04196: Histidine-rich glycoprotein precursor; P06727: Apolipoprotein A-IV precursor; P19652: Alpha-1-acid glycoprotein 2 precursor; P68871/P02042: Hemoglobin beta chain/Hemoglobin delta chain; P60709: Beta actin.

A method of diagnosing or monitoring a psychotic disorder, or predisposition thereto, comprises measuring, in a sample taken from a subject, the level of a biomarker selected from clusterin precursor, inter α-trypsin inhibitor, IgM, apolipoprotein A2 and α2 H5 glycoprotein.

A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.

The present invention provides a method for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Heat Shock Protein 90 (Hsp90) inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject. The present invention also provides pharmaceutical compositions comprising an amount of an oligonucleotide which reduces clusterin expression, and a Hsp90 inhibitor for use in treating a mammalian subject affected by prostate cancer. Also provided are oligonucleotides which reduce clusterin expression for use in combination with a Hsp90 inhibitor in treating a mammalian subject affected by prostate cancer, and a composition for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Hsp90 inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject.

Rheumatoid arthritis and other autoimmune diseases are diagnosed by multiplex assays for antibodies to a panel of antigens that includes cyclic citrullinated peptide and at least five members of a list that includes BRAF1 506-525, BRAF2 656-675, Vimentin (protein) citrullinated, Vimentin 415-433 cit cyclic, Vimentin 58-77 cit3 cyclic, Clusterin 231-250 cit sm1 cyclic, Fibrinogen A 556-575 cit sm cyclic, Fibrinogen A 616-635 cit sm cyclic, Histones2A H2A/a 1-20 cit sm2 cyclic, Filaggrin 48-65 cit2v1 cyclic, BRAF (catalytic domain from v raf murine sarcoma viral oncogene homologue B1, amino acids 416-766).

The present invention relates to methods and compositions for monitoring, diagnosis, prognosis, and determination of treatment regimens in subjects suffering from or suspected of having a renal injury. In particular, the invention relates to using assays that detect one or more markers selected from the group consisting of Clusterin, Heart-type fatty acid binding protein, Hepatocyte growth factor, Interferon gamma, Interleukin-12 subunit beta, Interleukin-16, Interleukin-2, 72 kDa type IV collagenase, Matrix metalloproteinase-9, Midkine, and Serum amyloid P-component as diagnostic and prognostic biomarkers in renal injuries.

The present invention relates to the field of biomarkers and, more specifically, to biomarkers useful in diagnosing aggressive prostate cancer. In specific embodiments, a method for diagnosing aggressive prostate cancer in a patient comprises (a) measuring the levels of one or more biomarkers in a sample collected from the patient; and (b) comparing the levels of the one or more biomarkers with predefined levels of the same biomarkers that correlate to a patient having aggressive prostate cancer and predefined levels of the same biomarkers that correlate to a patient not having aggressive prostate cancer, wherein a correlation to one of the predefined levels provides the diagnosis. In a specific embodiment, the one or more biomarkers may comprise cathepsin-L (CTSL), periostin, microfibrillar-associated protein 4 (MFAP4), collagen XII, neprilysin, clusterin, neutrophil gelatinase associated lipocalin (NGAL), epithelial cell activating molecule (EpCAM), prostate specific antigen (PSA), membrane metallo-endopeptidase (MME) and asporin (ASPN).

A method for treating a mammalian subject afflicted with prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) an androgen receptor antagonist having the structure

or a pharmaceutically acceptable salt thereof, each in an amount that when in combination with the other is effective to treat the mammalian subject.