43results about How to "Good primer specificity" patented technology

The invention discloses a hypsizygus marmoreus GJ5 strain as well as SSR marker primers and application thereof. The preservation number of the hypsizygus marmoreus GJ5 strain is CCTCC M 2020506; theSSR marker primers comprise five pairs of SSR specific marker primer combinations, and the five pairs of SSR specific marker primers form a fingerprint spectrum. The application comprises the following detection steps: extracting genome DNA of hyphae or sporocarp of a strain to be detected; carrying out SSR molecular marker amplification; carrying out electrophoresis detection; and comparing an electrophoretic band with the fingerprint spectrum, wherein the bacterial strain consistent with the fingerprint spectrum is the hypsizygus marmoreus GJ5 strain. Compared with conventional morphologicaldetection, antagonism experiments and fruiting experiment methods, the SSR fingerprint has the advantages of being short in detection time, high in accuracy, good in repeatability and the like, and the SSR fingerprint constructed through the SSR fingerprint can be used for distinguishing the hypsizygus marmoreus GJ5 strain from 23 main cultivated varieties of hypsizygus marmoreus.

The invention provides a method for detecting fluorescent quantitative PCR of 12 pathogenic bacteria in real time at the same time, including the steps: collecting specific pathogenic gene or toxin gene of the target pathogen and using it as a target gene to design primers and probes so as to make the reaction conditions consistent; extracting a genome template of a sample to be detected; adding the template respectively into tubules equipped with different specific upstream and downstream primers and probes, and then adding the corresponding fluorescent quantitative PCR reagents; under the same cycle of fluorescent quantitative PCR, the corresponding primers and probes are used to detect the samples simultaneously, quickly and quantitatively in their respective reaction tubes. Easier, Quick and efficient, Twelve common pathogenic bacteria (Escherichia coli O157: H7, Listeria monocytogenes, Salmonella, Vibrio parahaemolyticus, Streptococcus betae, Yersinia enterocolitica, Streptococcusfaecalis, Shigella, Proteus mirabilis, Vibrio fluvialis, Campylobacter jejuni, Staphylococcus aureus) can be detected simultaneously in drinking water and food economically.

The invention discloses a primer applied to rice photosensitive male nucleic male sterility gene lncR parting and an application thereof. The base sequence of the primer is as follows: an upstream primer, namely 5'-ATCCCACAAATCCTTTAGCA-3', and a downstream primer, namely 5'-CCGTTATAGATAGACCCGAGA-3'. The invention further provides an application of the primer in the rice photosensitive male nucleic male sterility gene lncR parting, and an application of the primer in photosensitive male nucleic male sterility rice seed selection. The primer for the rice photosensitive male nucleic male sterility gene lncR parting is good in specificity and is simple, effective and high in accuracy when being applied to a CAPS or an HRM molecular marker to part the rice photosensitive male nucleic male sterility gene lncR.

The invention relates to the biological detection technology, in particular to primers for detecting citrus canker pathogenic bacteria and a detection method thereof. The invention aims to provide the primers and method for dual PCR-DHPLC detection of the citrus canker pathogenic bacteria. The primers for detecting the citrus canker pathogenic bacteria of the invention have good primer specificity and high detection sensitivity; and the detection method of the invention has high accuracy and high sensitivity and can quickly and simply judge whether a sample has the citrus canker pathogenic bacteria or not, thereby ensuring the safety in import and export.

The invention discloses a one-step droplet digital PCR method for quantitatively detecting the GII type norovirus in fruits and vegetables. According to the method, RT-ddPCR is utilized, a primer and a probe for RT-qPCR detection of the GII type norovirus are combined for use, reaction is carried out, and then the high-sensitivity rapid detection for the GII type norovirus is realized. The method is high in sensitivity and can achieve about 2copies / [mu] L, but the sensitivity of the conventional RT-qPCR is usually 10 copies / [mu] L; the amplification efficiency is high, the amplification efficiency is 95.4%, R2 is equal to 0.9973. Under low copy number, compared with RT-qPCR, the method provided by the invention can more effectively avoid the influences of inhibitors in fruits and vegetables, and the false negative generation is reduced. Therefore, the detection method provided by the invention is sensitive, accurate and visual, a novel detection method is provided for the government departments including the agriculture department and the inspection and quarantine bureau, and related detection mechanisms and enterprises, and guiding significance is also achieved.

The invention discloses a quadruple PCR detection method capable of identifying canine parvovirus, hundestaupe virus, canine parainfluenza virus and canine adenovirus type-2, belonging to the field of virus detection. With the adoption of the method, four viruses including canine parvovirus, hundestaupe virus, canine parainfluenza virus and canine adenovirus type-2 can be simultaneously detected, the operation is simple, the detection speed is high, and the throughput is high; the accuracy is high, the specificity is good, the repeatability is good, the analysis can be accurately and rapidly carried out at high throughput, and the method is suitable for being popularized and applied in clinical practice. A primer provided by the invention is good in specificity, can be combined with the four target viral nucleic acids needing to be detected, and can not be combined with other common viral nucleic acids, such as feline distemper, canine adenovirus type I and leptospira canicola.

The invention provides two pairs of primers for detecting germs of paddy bacterial glume blight. The nucleotide sequences of the primers are SEQ ID NO.1: 5'-ACACGGAACACCTGGGTA-3', SEQ ID NO.2: 5'-TCGCTCTCCCGAAGAGAT-3', SEQ ID NO.3: 5'-GCAGCGGCAAGGAAGACG-3', and SEQ ID NO.4: 5'-GTCGTCGCCCGACGTCTC-3'. The invention also provides a method for detecting germs of paddy bacterial glume blight, which comprises the following steps: separating the germs of paddy bacterial glume blight in samples, using the bacterial DNA as a template, carrying out dual PCR amplification by using the primers, carrying out DHPLC analysis on the amplification products, and amplifying the obtained positive results by the primers BGF3 and BGR3 to obtain positive fragments as molecule specimens for carrying out identification. The invention has good primer specificity and high accuracy and high sensitivity of the detection method, thereby ensuring safety in import and export.

The invention provides primers for detecting sugarcane rust and a detection method thereof. The nucleotide sequences of the primers are represented by PM1 and PM2 in a sequence table. The invention further provides the method for detecting sugarcane rust; according to the method, total DNA of a sample is used as a template, the above-mentioned primers are used for PCR amplification, and determination is carried out according to the position of specifically amplified segments after amplification is finished. The method provided in the invention can effectively overcome defects in conventional detection methods like field symptom observation and indoor microscope or electron microscope observation, can rapidly, accurately, specifically and sensitively detect sugarcane rust and can be used for large scale sugarcane rust PCR detection.

The invention relates to a primer for coxsackie virus A16 nucleic acid detection, probe and kit, wherein the nucleotide sequence of the primer is that: forward primer 5'-GAACCATCACTCCACACAGGAG-3'; backward primer 5'-GTACCCGTGGTGGGCATTG-3' and the nucleotide sequence of the probe is 5'-CAGCCATTGGGAATTTCTTTAGCCGTG-3'. The invention also provides a method for detecting coxsackie virus A16 nucleic acid. Sample RNA is used as template and the above primer and probe are subjected to real-time fluorescence RT-PCR amplification and the result is predicated based on the amplification curve after each circulation. The primer specificity is good, the detection method is quick and simple, the accuracy and the sensitivity is high and the invention provides scientific reference for etiologic diagnosis and differential diagnosis of hand-foot-mouth disease and relative diseases.

The invention discloses a kit for diagnosing Von Hippel-Lindau (VHL) disease. The kit for diagnosing the VHL disease comprises a primer pair 1 consisting of deoxyribonucleic acid (DNA) molecules shown as SEQ ID No.1 and DNA molecules shown as SEQ ID No.2, a primer pair 2 consisting of DNA molecules shown as SEQ ID No.3 and DNA molecules shown as SEQ ID No.4, and a primer pair 3 consisting of DNA molecules shown as SEQ ID No.5 and DNA molecules shown as SEQ ID No.6. Experiments prove that the kit ensures that a polymerase chain reaction (PCR) amplification product has a specific strip and hardly has a mixed strip, has a specific, clear and accurate sequencing result, and does not have any uncertain alkali group, namely the primers in the kit have high specificity, and a few mixed strips exist; and the kit provides convenience for screening family members with the VHL disease, and lays a foundation for fulfilling the aims of early discovery, early diagnosis and early treatment.

The invention discloses a detection primer, a probe and a detection method of human astrovirus nucleotide, belonging to the technical field of biological detection. The detection primer of the human astrovirus nucleotide comprises a forward primer and a reverse primer, the nucleotide sequences of which are shown as SEQ NO.1 and SEQ NO.2. A nucleotide sequence of the probe which is matched with the detection primer is shown as SEQ NO.3; and one end of the probe is signed with a report fluorescent dye, and the other end of the probe is signed with a quenching fluorescent dye. The detection method of the human astrovirus nucleotide comprises the following steps of: carrying out real-time fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) amplification by taking a sample RNA (Ribonucleic Acid) to be detected as a template and utilizing the forward primer, the reverse primer and the probe, collecting data after every one circulation is finished, and judging a result according to an amplification curve after the reaction is finished. The primer designed according to a human astrovirus genomic sequence is good in specificity and is high in sensitivity when being used for real-time fluorescent RT-PCR detection.

The invention discloses a method for establishing DNA (deoxyribonucleic acid) fingerprint spectra of peanut aspergillus flavus in different producing areas with an ISSR (inter-simple sequence repeat) molecular marker technology. The method comprises steps as follows: aspergillus flavus DNA extraction, ISSR-PCR (inter-simple sequence repeat-polymerase chain reaction) and electrophoretogram analysis of reaction products, wherein primers adopted in the ISSR-PCR include an R1 primer, an R2 primer and an R3 primer, the R1 primer is AGA GAG AGA GAG AGA GG, the R2 primer is CAC ACA CAC ACA CAC AA, and the R3 primer is AGA GTT GGT AGC TCT TGA TC. The method is stable, has good reproducibility and is easy to master; the selected primers have good specificity, aspergillus flavus contamination of main peanut producing areas in China can be traced back to a single producing area or a district with a smaller range, and the method can be taken as an origin traceability theoretical method and technical support for the aspergillus flavus contamination of the main peanut producing areas in China.

The invention discloses a molecular marker primer composition for identifying inter-hybrid seeds of pears and apples and an application thereof. Specific sequences of pear and apple genomes are detected by a method of whole genome comparison, seven pairs of molecular marker specific primers P13, P31, P33, A31, A33, A34 and A37 are developed newly, and positive and negative primer sequences are asshown in a table 1. By identifying the inter-hybrid offsprings of pears and apples by means of the specific primers, specific amplified strips of the pears, apples and hybrid offsprings can be obtained, separately, that is, the inter-hybrid seeds of the pears and the apples are detected truly. The molecular marker based on the specific sequences of the genomes can be used for identifying the inter-hybrid seeds of pears and apples and has important theoretical and practical guiding meaning in improving genetic breeding progress of fruit trees and accelerating molecular assisted selective breeding.

The invention provides two primer pairs. One primer pair includes nucleotide sequences shown as SEQ ID NO:1 and SEQ ID NO:2, and the other primer pair includes nucleotide sequences shown as SEQ ID NO:3 and SEQ ID NO:4. The invention further provides application of the two primer pairs in preparing products for detecting the Zika virus. The invention further provides a reagent kit comprising the two primer pairs and application. As proved by experiments, the two primer pairs are good in specificity and repeatability and high in sensitivity, and a Zika virus detecting method established based on the two primer pairs can be used for sensitively, accurately, stably and rapidly detecting whether the Zika virus exists or not and has great significance on clinical rapid diagnosis and public prevention and control over the Zika virus in China.

The invention discloses a method, primer, probe and kit for detecting cronobacter sakazakii. The primer and probe for fluorogenic quantitative PCR detection are designed according to a conserved sequence of a cronobacter sakazakii genome; fluorogenic quantitative PCR detection technique of cronobacter sakazakii is established; and whether cronobacter sakazakii exists can be determined according to an amplification curve after a reaction is over. The sequence of the primer comprises an upstream primer sequence of 5'GGGATACGCAGGAGGTGGCA' and a downstream primer sequence of 5'GATGCTGCCTGCCAGCAGG'. The sequence of the probe is 5'CATTTTAGCGCTTGATACTCCCCTGGGC'. According to the invention, the method for detecting cronobacter sakazakii is good in accuracy and high in sensitivity, and whether cronobacter sakazakii exists in a sample can be fast and simply determined.

The invention provides a primer for detecting the Nanog gene expression quantity during mesenchymal stem cell passage. The primer comprises Nanog-F ATGCCTGGTGAACCCGAC, Nanog-R AGGACTGGATGTTCTGGGT, beta-actin-F CACGAAACTACCTTCAACTCC and beta-actin-R CATACTCCTGCTTGCTGATC. A method for detecting the Nanog gene expression quantity during mesenchymal stem cell passage includes steps of (1), extracting mesenchymal stem cells and carrying out subculturing; (2), extracting total RNA (ribonucleic acid) in each generation of mesenchymal stem cells and carrying out RT-PCR (reverse transcription-polymerase chain reaction) amplification; (3), carrying out real-time fluorescent quantitative PCR amplification on amplified genes by the aid of the primer. The primer and the method have the advantages that the primer is good in specificity and high in accuracy and sensitivity, the method is simple, and subtle change of the gene expression quantity can be detected by the aid of the primer and the method.

The invention discloses a rice GS3 mutant gene and a molecular marker and application thereof. The rice GS3 mutant gene is obtained by deleting three CTC bases behind the 5932 base of the rice GS3 gene, and the mutation site is located at the fifth exon. The invention also discloses a molecular marker aiming at the molecular marker, further discloses a molecular marker combination containingthe molecular marker, and provides application. According to the invention, key variation of grain shape regulation of the fifth exon of the rice GS3 gene is discovered and identified, 3bp deletion mutation participates in regulation of grain shape traits of rice, and the mutation can be used as another screening target for grain shape improvement breeding in the future. The invention develops aneffective dCaps marker and molecular marker combination which can be used for distinguishing and selecting rice grain types, identifying varieties, breeding rice and the like.

The invention relates to a qPCR (quantitative polymerase chain reaction) primer for detecting NS2 genes of rice stripe viruses and a detection method of the qPCR primer. The sequence of the primer includes ATCAACAGACGGAGCATC for NS2-qPCRF and GATTGGTTACAACTATGTGCTT for NS2-qPCRR. GC content of the primer is 36-50%, amplified fragments are 107bp, specificity is high, primer dimers do not exist, standard curves corresponding to the premier meet the requirements of the qPCR premier, and accordingly, the qPCR primer is quite suitable for detection of corresponding target gene expression quantity of the primer.

The invention discloses prawn white spot virus LAMP primers, a kit and a detection method, wherein the primers include: a forward outer primer F3, a reverse outer primer B3, a forward inner primer FIP, and a reverse inner primer BIP. The purpose of the present invention is to provide a kind of prawn white spot virus LAMP primer in order to overcome the deficiencies in the prior art; Another purpose of the present invention is to provide a kind of test kit comprising above-mentioned primer; Another purpose of the present invention is to provide A method for detecting prawn white spot virus by using the above kit, the detection method has the characteristics of strong primer specificity, simple and fast equipment, high detection sensitivity, closed-tube detection, simple operation, and the results can be directly interpreted and the like.

The invention discloses an isothermal amplification primer set capable of detecting pork and duck derived components at the same time and a kit thereof. The isothermal amplification primer set comprises (1) a primer used for detecting the pork source component and (2) a primer used for detecting the duck derived component. According to the isothermal amplification primer set capable of detecting the pork and duck derived components at the same time and the kit thereof, the pork derived component and the duck derived component can be subjected to cross primer isothermal amplification at the same time, and by adoption of a nucleic acid test strip, the two meat derived components in samples can be rapidly detected.

The invention discloses a PCR (polymerase chain reaction) kit for detecting Wenckebach eperythrozoon, which contains specific primers for detecting 16 SrRNA genes of Wenckebach eperythrozoon, wherein an upstream primer is shown in SEQIDNO.1, and a downstream primer is shown in SEQIDNO.2, the primers can specifically expand 16 SrRNA genes of Wenckebach eperythrozoon, but can not expand 16 SrRNA gene segments of mycoplasma suis, eperythrozoon ovis and escherichia coli, the sensitivity of the primers is high, and the minimum detectable amount is 1.1*10<-6> mu g / mL. The PCR kit disclosed by the invention is applied to clinical diagnosis, stable in performance, convenient to operate, and easy to be standardized.

The invention provides a primer for quantitatively determining Twist-1 gene expression quantity in mesenchymal stem cells, a standard product and a detection method. The primer sequence is shown as SEQ ID No: 1 and SEQ ID No: 2. The detection method comprises the following steps of extracting total RNA of the mesenchymal stem cells; then performing inverse transcription to synthesize cDNA; using cDNA as a template; using the primer for PCR amplification; recovering and purifying amplification products for preparing plasmid standard products; drawing a standard curve; using cDNA of a sample tobe tested as a template; using the primer for fluorescent quantitative PCR reaction to obtain a Ct value of a sample to be tested; calculating the copy number of Twist-1 genes in the sample to be tested according to the standard curve. When the primer, the standard product and the detection method provided by the invention are used for performing repeated detection on the Twist-1 gene expression quantity in the mesenchymal stem cells, the repeated performance is good; the accuracy is high; the sensitivity is high; the detection time is short.

The invention discloses primers, a kit and a method for detecting potato virus X. The primers contain PVX-F3, PVX-B3, PVX-FIP and PVX-BIP. For overcoming the defects in the prior art, the invention aims at providing the primers for RT-LAMP detection of the potato virus X, wherein the primers have the characteristics of fastness, simplicity, convenience, efficiency, high accuracy, high specificityand high sensitivity. The invention also aims at providing the kit which contains the primers and is used for detecting the potato virus X and the method for the RT-LAMP detection of the potato virusX.

The invention relates to a hybridized membrane strip capable of being used for medically diagnosing genetic non-syndromic deafness of people, in particular to a non-syndromic deafness gene detection membrane strip and a PCR (polymerase chain reaction) primer used for amplifying gene segments of a to-be-detected sample. The gene detection membrane strip comprises a substrate as well as normal contrast probes and specific mutation detection probes which are fixed on the substrate and totally comprises 20 mutation detection probes for detecting 20 gene mutation sites and 10 normal contrast probes. The gene detection membrane strip can detect 20 gene mutation sites in 20 mutation types, is used for detection, can directly diagnose the gene types of a to-be-detected person and has the advantages of being high in accuracy, high in specificity, capable of detecting a recessive gene carrier and the like.

The invention provides a primer combination, a probe, a gene chip, a kit and a system for detecting an HLA-5801 gene, and relates to the technical field of biology. The primer combination, the probe, the gene chip and the kit T have a nucleotide sequence as shown in any one of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.9 and SEQ ID NO.10. The primer combination can accurately detect applicability of allopurinol of a biological sample, and has good specificity, sensitive reaction and short detection time. The method is simple and has low cost and high clinical application value.

The invention discloses a method of detecting nucleotides of Bacillus cereus, primers for detecting and probes, belonging to the technical field of biological detection. According to the invention, the primers designed according to genome sequence of the Bacillus cereus are good in singularity, and high in sensitivity if used for fluorescence PCR detection. The detection method provided by the invention is high in accuracy and sensitivity, can rapidly and simply determine whether samples contain the Bacillus cereus, and provides scientific basis for etiological diagnosis and differential diagnosis of the Bacillus cereus in various dairy products.

The invention discloses a one-step droplet digital PCR method for quantitatively detecting the GII type norovirus in fruits and vegetables. According to the method, RT-ddPCR is utilized, a primer and a probe for RT-qPCR detection of the GII type norovirus are combined for use, reaction is carried out, and then the high-sensitivity rapid detection for the GII type norovirus is realized. The method is high in sensitivity and can achieve about 2copies / [mu] L, but the sensitivity of the conventional RT-qPCR is usually 10 copies / [mu] L; the amplification efficiency is high, the amplification efficiency is 95.4%, R2 is equal to 0.9973. Under low copy number, compared with RT-qPCR, the method provided by the invention can more effectively avoid the influences of inhibitors in fruits and vegetables, and the false negative generation is reduced. Therefore, the detection method provided by the invention is sensitive, accurate and visual, a novel detection method is provided for the government departments including the agriculture department and the inspection and quarantine bureau, and related detection mechanisms and enterprises, and guiding significance is also achieved.