Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

43 results about "Human astrovirus" patented technology

Astrovirus is a type of virus that was first discovered in 1975 using electron microscopes following an outbreak of diarrhea in humans.

Gene chip and reagent box for detecting food-borne virus

The invention relates to a gene chip for detecting food-home virus and a kit, belonging to the inspection field. The surface of a solid phase carrier is fixed with a plurality of detection probes and quality control contrast probes, wherein, the detection probes consist of the probes for detecting hepatitis A virus, human astrovirus, norwalk virus G1, norwalk virus G2, rotavirus, polio virus 1, polio virus 2 and polio virus 3; and the quality control contrast probes consist of a spotting positive quality control probe, a chip hybridization positive quality control probe and a chip negative quality control probe. The gene chip and the kit have the advantages of: (1) high throughout: five common viruses are integrated and detected simultaneously, and the practicability is strong; (2) rapidness: the detection time is only 4 hours; (3) specificity: the false positive caused by the cross reaction is avoided; (4) flexibility: the detection flexibility of the chip is 10<8> virus particles per gram of the tissue sample, which is higher than that of RT-PCR; and (5) good repetitiveness and stable results. The gene chip and the kit can be widely applied to the food safety inspection of the inspections system.
Owner:PEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU +1

Novel astrovirus

This invention relates to the isolation and uses of novel avian astroviruses. The present invention also relates to vaccines, kits and methods for detection of a novel astrovirus. The present invention further relates to vaccination of avians, prevention and / or treatment of avian infections associated with astrovirus. Infections of poultry by this novel astrovirus are associated with runt stunting syndromes.
Owner:BIOMUNE

Preparation method and product of goose astrovirus egg yolk antibody

The invention discloses a preparation method and a product of a goose astrovirus egg yolk antibody. The preparation method comprises the following steps: (1) preparing an astrovirus liquid and an adjuvant, using the astrovirus liquid and the adjuvant as immunogens to immunize a healthy laying goose to prepare a highly immunized egg, collecting the highly immunized egg; (2) disinfecting the highlyimmunized egg, collecting an egg yolk; and extracting the egg yolk antibody from the egg yolk by using an acid water-carrageenan method. The recovery rate of the goose astrovirus egg yolk antibody extracted through the preparation method is more than 93%, the purity is more than 95%, and the indexes like the recovery rate, the extracting quantity and the purity of the goose astrovirus egg yolk antibody are obviously better than those of the goose astrovirus egg yolk antibody prepared by using the existing method. The goose astrovirus egg yolk antibody prepared by using the preparation method achieves the better protecting effect only by 0.5 ml of a preventive dose, and the rate of protection against the virulent strain reaches 100%. The infection and the outbreak of the goose astrovirus isprevented specifically, meanwhile, the production process is simplified, and the preparation method can implement large-scale production and is applied clinically.
Owner:ε“ˆθ―ι›†ε›’η”Ÿη‰©η–«θ‹—ζœ‰ι™ε…¬εΈ

Detection primer, probe and detection method of human astrovirus nucleotide

The invention discloses a detection primer, a probe and a detection method of human astrovirus nucleotide, belonging to the technical field of biological detection. The detection primer of the human astrovirus nucleotide comprises a forward primer and a reverse primer, the nucleotide sequences of which are shown as SEQ NO.1 and SEQ NO.2. A nucleotide sequence of the probe which is matched with the detection primer is shown as SEQ NO.3; and one end of the probe is signed with a report fluorescent dye, and the other end of the probe is signed with a quenching fluorescent dye. The detection method of the human astrovirus nucleotide comprises the following steps of: carrying out real-time fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) amplification by taking a sample RNA (Ribonucleic Acid) to be detected as a template and utilizing the forward primer, the reverse primer and the probe, collecting data after every one circulation is finished, and judging a result according to an amplification curve after the reaction is finished. The primer designed according to a human astrovirus genomic sequence is good in specificity and is high in sensitivity when being used for real-time fluorescent RT-PCR detection.
Owner:SOUTH CHINA UNIV OF TECH

Goose-origin kidney-type astrovirus GoAstV rapid diagnosis primer probe group, detecting method and application

The invention belongs to the technical field of the gene detection, and particularly relates to a goose-origin kidney-type astrovirus GoAstV rapid diagnosis primer probe group, a detecting method andapplication. The goose-origin kidney-type astrovirus GoAstV rapid diagnosis primer probe group comprises probe primer groups in the following sequences: GoAstV-F: 5' TGGTGGTGGTGCGGTTTT 3'; GoAstV-R: 5' GGGCAACGTACCATCATAACG 3'; and a TaqMan MGB probe: 5' FAM TGTAGAGACGGACTGGAC MGB 3'. The 5' end is marked as a fluorescence group by the probe, and the 3' end is marked as a quenching fluorescence group. The provided primer probe group has the advantages of higher sensibility, specificity, good repeatability, rapidness, high flux, less pollution and the like, and is used as a useful and powerfultechnology in the fields of a fundamental research, an application research and the like.
Owner:POULTRY INST SHANDONG ACADEMY OF AGRI SCI SHANDONG SPECIFIC PATHOGEN FREEN CHICKS RES CENT

Gene chip and reagent box for detecting food-borne virus

The invention relates to a gene chip for detecting food-home virus and a kit, belonging to the inspection field. The surface of a solid phase carrier is fixed with a plurality of detection probes and quality control contrast probes, wherein, the detection probes consist of the probes for detecting hepatitis A virus, human astrovirus, norwalk virus G1, norwalk virus G2, rotavirus, polio virus 1, polio virus 2 and polio virus 3; and the quality control contrast probes consist of a spotting positive quality control probe, a chip hybridization positive quality control probe and a chip negative quality control probe. The gene chip and the kit have the advantages of: (1) high throughout: five common viruses are integrated and detected simultaneously, and the practicability is strong; (2) rapidness: the detection time is only 4 hours; (3) specificity: the false positive caused by the cross reaction is avoided; (4) flexibility: the detection flexibility of the chip is 10<8> virus particles per gram of the tissue sample, which is higher than that of RT-PCR; and (5) good repetitiveness and stable results. The gene chip and the kit can be widely applied to the food safety inspection of the inspections system.
Owner:PEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU +1
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products