Prawn white spot syndrome virus LAMP primer, kit and detection method
A white spot virus and detection method technology, applied in the field of shrimp white spot virus LAMP primers, can solve the problems of no effective control measures for the virus, difficult to achieve sensitivity, loss of shrimp farming, etc., and achieve good practical value, low detection cost, and high sensitivity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] A kind of shrimp white spot virus LAMP primer of the present invention comprises:
[0082] Forward primer F3: 5'GTTGAAGAAATGAGACCGG3';
[0083] Reverse outer primer B3: 5'GGTTTGTAGGCTAATGTCCAT3';
[0084] Forward Inward Primer FIP:
[0085] 5'AACACCACTAGTGGTCTACCTCTCTT-TCAATGAAGCATCCGAAAC3';
[0086] wherein the forward inner primer FIP comprises F1c and F2:
[0087] F1c: 5'AACACCACTAGTGTCTACCTCTCTT3';
[0088] F2: 5'TCAATGAAGCATCCGAAAAC3';
[0089] Reverse inner primer BIP:
[0090] 5'TTGCTCCTGCAATAGCTGGC-GCCTCTTTTCATATTCTTTCCTT3';
[0091] Wherein the reverse inner primer BIP includes B1c and B2:
[0092] Wherein B1c: 5'TTGCTCCTGCAATAGCTGGC3';
[0093] B2: 5'GCCTCTTTTCATATTCTTTCCTT3'.
Embodiment 2
[0095] A shrimp white spot virus LAMP kit of the present invention, the kit includes:
[0096]
[0097] Wherein the primers include:
[0098] Forward primer F3: 5'GTTGAAGAAATGAGACCGG3';
[0099] Reverse outer primer B3: 5'GGTTTGTAGGCTAATGTCCAT3';
[0100] Forward Inward Primer FIP:
[0101] 5'AACACCACTAGTGGTCTACCTCTCTT-TCAATGAAGCATCCGAAAC3';
[0102] wherein the forward inner primer FIP comprises F1c and F2:
[0103] F1c: 5'AACACCACTAGTGTCTACCTCTCTT3';
[0104] F2: 5'TCAATGAAGCATCCGAAAAC3';
[0105] Reverse inner primer BIP:
[0106] 5'TTGCTCCTGCAATAGCTGGC-GCCTCTTTTCATATTCTTTCCTT3';
[0107] Wherein the reverse inner primer BIP includes B1c and B2:
[0108] Wherein B1c: 5'TTGCTCCTGCAATAGCTGGC3';
[0109] B2:5'GCCTCTTTTCATATTCTTTCCTT3';
[0110] Among them, the product specification of the kit: 40 times.
[0111] The primers include 1.6 μl forward outer primer F3, 1.6 μl reverse outer primer B3, 0.2 μl forward inner primer FIP, and 0.2 μl reverse inner primer BIP....
Embodiment 3
[0113] A method for detecting prawn white spot virus LAMP of the present invention comprises the following steps:
[0114] A, extracting sample DNA; wherein said sample is dried shrimp;
[0115] B. Establish a LAMP reaction system:
[0116] Take various reagents from the kit according to the required reaction volume, put them into sterilized test tubes, and prepare a premix on ice; flick the sterilized test tube to mix it up, and centrifuge briefly for a few seconds to concentrate the solution in the sterilized test tube. Bottom of tube; 20 μL LAMP reaction includes:
[0117]
[0118]
[0119] C. Add sample:
[0120] Add 5 μL of the RNA of the sample to be tested, the negative control reaction sample, and the positive control reaction sample to three sterilized test tubes containing 20 μL of LAMP reaction body, respectively, to make the total amount of each to reach 25 μL, cover the test tube cap and tap lightly Mix and centrifuge briefly to concentrate the reaction s...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com