36 results about "Enterocytozoon hepatopenaei" patented technology

The invention discloses a fluorescence detection kit for detecting prawn enterocytozoon hepatopenaei (EHP) in China and relates to detection of prawn diseases. The fluorescence detection kit is provided with a tissue lysis solution, a constant-temperature fluorescence process reaction solution, a positive reference substance and a negative reference substance. Application of the fluorescence detection kit comprises the following steps: extraction of prawn tissue DNA; constant-temperature fluorescence amplification of prawn EHP; result judgment of the constant-temperature fluorescence detection of prawn EHP. According to the fluorescence detection kit performing EHP detection through the constant-temperature fluorescence process, a positive sample can show a high-linearity amplification curve after being amplified by a constant-temperature fluorescence amplification apparatus, and also has a higher amplification rate; the result of a sensitivity experiment indicates that the fluorescence detection kit has higher sensitivity and can be applied to a quantitative experiment. A constant-temperature fluorescence primer with strong specificity, high sensitivity and high amplification efficiency is designed and developed for the genome DNA of prawn EHP; compared with a common LAMP primer, a loop primer is added, the amplification efficiency is higher, and the detection is faster.

The invention dislcoses an RAA (recombinase-aid amplification) constant-temperature fluorescence detection method and a detection kit for EHP (enterocytozoon hepatopenaei). The detection kit comprisesa forward primer SEQ ID NO. 1, a reverse primer SEQ ID NO. 2, a specific fluorescence probe SEQ ID NO. 3, reaction liquid, recombinant polymerase and a reference substance. The kit has the advantagesthat the specificity is strong; the detection sensitivity is high, and can reach 100fg/mu L; high accuracy and reliability are achieved; the operation is simple and rapid, and the kit is suitable forfield detection and has wide application scenarios.

The invention discloses an LAMP detection kit for Enterocytozoon hepatopenaei. The LAMP detection kit comprises a tissue lysate and an LAMP amplification reaction solution, wherein the LAMP amplification reaction solution comprises 1.4 mM LAMP inner primer, 0.2 mM LAMP outer primer, 20 mM Tris-HC, 10 mM potassium chloride, 15 mM ammonium sulfate, 8 mM magnesium sulfate, 0.1% Triton X-100, 0.6 M betaine, 1.4 mM dNTP, 2.5 U/[mu]L Bst DNA polymerase large fragment, 1.25 mM calcein, 25 mM MnCl2, and the balance of water. The detection kit of the present invention has advantages of strong specificity, high sensitivity and quick and easy operation, can overcome the incapable application problem of the existing detection method in the breeding disease monitoring, and is suitable for the screening and the prevention of Enterocytozoon hepatopenaei.

The present invention discloses a medicinal bait additive for preventing and treating enterocytozoon hepatopenaei of litopenaeus vannamei. The medicinal bait additive comprises the following components in parts by weight: 8-32 parts of marine red yeast powder, 30-75 parts of albendazole, 8-32 parts of spirulina powder and 5-10 parts of garlic powder. The medicinal bait additive is used in a compound feed for the litopenaeus vannamei and has an addition amount of only 6-12%; and the medicinal bait additive can also be mixed with the feed at a weight ratio of 1:10 for feeding before feeding. Themedicinal bait additive uses an internal administration route, so that a medicine internal environment is formed in a host body, the medicinal bait additive is subjected to blood circulation to reachtarget organs and parasites cannot survive. The medicinal bait additive can effectively kill the enterocytozoon hepatopenaei in the litopenaeus vannamei body, is non-toxic to the litopenaeus vannameibody, does not cause medicine residues in the litopenaeus vannamei body, at the same time also does not cause pollution to the breeding environment, and can effectively play a therapeutic role in thediseased litopenaeus vannamei infected by the enterocytozoon hepatopenaei.

The invention discloses a composite preparation for killing prawn enterocytozoon hepatopenaei and an application method of the composite preparation. The composite preparation is prepared from the following raw materials by mass percent: 4.5 to 6.0 percent of albendazole, 5.0 to 8.0 percent of betel nut extract, and 86.0 to 90.5 percent of corn starch auxiliary materials. The betel nut extract is extracted in a laboratory and obtained by virtue of boiling, concentrating and freeze-drying, and one kilogram of betel nuts can be prepared into 100 grams of extract. The composite preparation has the beneficial effects that the composite preparation is safe to a target animal; by using the composite preparation, the prawn enterocytozoon hepatopenaei can be effectively killed, and the requirement for preventing the enterocytozoon hepatopenaei in the cultivation process of prawns can be met; and the preparation process is simple, the use is convenient, and the application prospect is good.

The invention provides an enterocytozoon hepatopenaei spore wall protein as well as preparation and application of a polyclonal antibody thereof, and belongs to the technical field of animal quarantine. The enterocytozoon hepatopenaei spore wall protein (EHP00_430) is positioned on the surfaces of enterocytozoon hepatopenaei spores in the infection period, has high abundance, plays an important role in the process that enterocytozoon hepatopenaei infects prawns, and is an important target for detection, prevention and control of enterocytozoon hepatopenaei. The enterocytozoon hepatopenaei spore wall protein provided by the invention is used for preparing a polyclonal antibody for resisting the EHP00_430 protein; and the polyclonal antibody is high in specificity, can be used for accuratelydetecting enterocytozoon hepatopenaei in the infection period, and can be applied to detection of enterocytozoon hepatopenaei pathogens.

The invention discloses an SWP2 protein-resistant monoclonal cell strain and an application thereof, and belongs to the technical field of agricultural and animal quarantine. On one hand, the invention provides a novel SWP2 protein-resistant monoclonal cell strain and a SWP2 monoclonal antibody secreted by the monoclonal cell strain, and on the other hand, the invention provides the application ofthe monoclonal cell strain and the SWP2 monoclonal antibody in preparing a reagent for detecting enterocytozoon hepatopenaei diseases. The monoclonal antibody generated by the SWP2 protein-resistantmonoclonal cell strain provided by the invention can be combined with an SWP2 antigen with high specificity, has high affinity, and can provide accurate results for judging whether shrimp bodies are infected with enterocytozoon hepatopenaei (EHP) or not.

The invention discloses a specific primer pair for rapidly detecting Enterocytozoon hepatopenaei by utilizing RPA-LFS, a detection kit and application of the detection kit. The detection kit comprisesthe specific primer pair and a probe, wherein an upstream primer is ACAATTTCAAACACTGTAAACCTTAAAGCA, a downstream primer is Bioten-TCATTCATTTTCCTTTTATCTTCTGATATG, and the probe is FITC-TAAAAAGAGACGATATTTACACAGACACAG[THF]ATTTGTAGGATATGA-C3Spacer. According to the specific primer pair, the detection kit and the application, disclosed by the invention, the Enterocytozoon hepatopenaei (Ehp) can be rapidly detected on site under a room-temperature environment through the RPA-LFS, a traditional long-time high-temperature detection method that a nest needs to depend on temperature control equipment is avoided, a result can be judged and read by naked eyes, more convenience is obtained, and the detection kit is suitable for diagnosing aquaculture animal diseases.

The invention discloses a visual rapid detection kit for enterocytozoon hepatopenaei (EHP). The visual rapid detection kit comprises a reagent A, a reagent B, a reagent C, a reagent D, a reagent E, areagent F, a reagent G and a detection tube loaded with a reagent H. The kit provided by the invention is high in detection specificity and detection sensitivity, and magnetic beads are adopted for extracting nucleic acid, thereby adequately extracting the nucleic acid out of a sample to be tested, avoiding the use of large-scale instruments, simplifying the complicated operation process and greatly shortening the time spent in nucleic acid extraction. The use of dye calcein can enable a user to strictly follow the principle of not opening a lid during a loop-mediated isothermal amplification(LAMP) reaction, thereby greatly reducing the false positive rate. The kit provided by the invention is simple and convenient in the whole operation process, and the detection can be finished within 1.5-2 hours without adopting high-end instruments.

The invention belongs to the technical field of marine organism pathogen detection, and particularly relates to a dual PCR (polymerase chain reaction) detection method and kit for simultaneously detecting shrimp enterocytozoon hepatopenaei and decapod iridovirus 1. The invention provides a duplex PCR (polymerase chain reaction) detection method for simultaneously detecting enterocytozoon hepatopenaei and tetrapod iridovirus 1, used PCR primers are shown as SEQ ID NO: 1 and SEQ ID NO: 2, and detected pathogenic gene segments do not need to be cloned, sequenced and subjected to sequence alignment. Whether a sample to be detected contains one or two of the two pathogens or not can be detected through one experiment. And a plurality of limitations of complicated operation, low sensitivity, low applicability and the like of the conventional single detection are overcome.

The invention discloses a penaeus vannamei breeding method based on detection of enterocytozoon hepatopenaei infection dose, and belongs to the technical field of penaeus vannamei breeding. According to the method, the infection dose of enterocytozoon hepatopenaei is regularly monitored in the whole culture period of the penaeus vannamei boone, and different culture measures are adopted for different infection doses. According to the method, high-quality shrimp seeds are selected for centralized thickening, pathogen indexes including enterocytozoon hepatopenaei are monitored regularly, and the shrimp seeds are cultivated in different pools after the shrimp seeds are subjected to thickening about one month and each item is detected to be qualified, so that compared with the technology of directly putting the shrimp seeds, on one hand, the cost is reduced through centralized management, and on the other hand, the risk of later-stage cultivation caused by missing detection of low disease-carrying rate of the shrimp seeds can be reduced. The vigor and ingestion growth conditions of the shrimps are observed at any time in the culture period, enterocytozoon hepatopenaei pathogens are monitored regularly, real-time fluorescent quantitative detection is supplemented if positive results are detected, treatment is carried out according to the method disclosed by the invention according to the culture period, the specification state of the shrimps and quantitative detection data, and the economic loss is reduced.

A method for purifying enterocytozoon hepatopenaei of prawns comprises the steps of taking hepatopancreas of a plurality of prawns infected with enterocytozoon hepatopenaei, removing membranes by grinding; diluting them to 35-40 ml with sterile water; conducting alternative centrifugation at 1500-2000 rpm and at 500-600 rpm till no precipitate is observed by the naked eyes; centrifuging the supernatant without precipitate at the high speed of 3000-3500 rpm, and taking and dissolving a precipitate in sterile water to serve as a crude extracting solution; adopting different concentrations of Percoll cell separation solutions for gradient separation; adding 1-1.5 ml of crude extracting solution at the topmost of the liquid level with set gradient; using a centrifugal machine to carry out centrifugation under the conditions of 15 DEG C and 9000-10000 rpm; and obtaining a purified enterocytozoon hepatopenaei suspension by washing. The purified enterocytozoon hepatopenaei has high purity andless impurities, and the operation is simple.

The invention discloses a primer set for simultaneously detecting three kinds of microsporidia and application of the primer set. The primer set comprises a first specific primer pair for detecting enterocytozoon hepatopenaei, a second specific primer pair for detecting enterocytozoon artemia and a third specific primer pair for detecting enterocytozoon eriocheir. The first specific primer pair aims at a shrimp enterocytozoon hepatopenaei ptp2 gene, the second specific primer pair aims at an enterocytozoon artemia STPK gene, and the third specific primer pair aims at an enterocytozoon eriocheir swp7 gene. According to the invention, the infection conditions of enterocytozoon hepatopenaei, enterocytozoon artemia and enterocytozoon eriocheir in shrimps and crabs can be rapidly and accuratelydetected through multiple PCR reactions, and the sensitivity and specificity are better.